2024-05-15 21:19:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_030428 76 bp RNA linear ROD 06-AUG-2023 DEFINITION Mus musculus microRNA 762 (Mir762), microRNA. ACCESSION NR_030428 VERSION NR_030428.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 76) AUTHORS Wang C, Chen Y, Cheng NT, Yang ZT, Tang HX and Xu M. TITLE MicroRNA-762 Modulates Lipopolysaccharide-induced Acute Lung Injury via SIRT7 JOURNAL Immunol Invest 51 (5), 1407-1422 (2022) PUBMED 34251977 REMARK GeneRIF: MicroRNA-762 Modulates Lipopolysaccharide-induced Acute Lung Injury via SIRT7. REFERENCE 2 (bases 1 to 76) AUTHORS Khan A, Yuewen W, Dil S, Shah W, Shi Q and Khan R. TITLE The evolutionarily conserved gene, Fam114a2, is dispensable for fertility in mouse JOURNAL Reprod Biol 21 (3), 100531 (2021) PUBMED 34315090 REMARK GeneRIF: The evolutionarily conserved gene, Fam114a2, is dispensable for fertility in mouse. REFERENCE 3 (bases 1 to 76) AUTHORS Lai PS, Chang WM, Chen YY, Lin YF, Liao HF and Chen CY. TITLE Circulating microRNA-762 upregulation in colorectal cancer may be accompanied by Wnt-1/beta-catenin signaling JOURNAL Cancer Biomark 32 (2), 111-122 (2021) PUBMED 34092606 REMARK GeneRIF: Circulating microRNA-762 upregulation in colorectal cancer may be accompanied by Wnt-1/beta-catenin signaling. REFERENCE 4 (bases 1 to 76) AUTHORS Gao H, Ni N, Zhang D, Wang Y, Tang Z, Sun N, Ju Y, Dai X, Zhang Y, Liu Y and Gu P. TITLE miR-762 regulates the proliferation and differentiation of retinal progenitor cells by targeting NPDC1 JOURNAL Cell Cycle 19 (14), 1754-1767 (2020) PUBMED 32544377 REMARK GeneRIF: miR-762 regulates the proliferation and differentiation of retinal progenitor cells by targeting NPDC1. REFERENCE 5 (bases 1 to 76) AUTHORS Qiang Z, Jin B, Peng Y, Zhang Y, Wang J, Chen C, Wang X and Liu F. TITLE miR-762 modulates thyroxine-induced cardiomyocyte hypertrophy by inhibiting Beclin-1 JOURNAL Endocrine 66 (3), 585-595 (2019) PUBMED 31522342 REMARK GeneRIF: modulates thyroxine-induced cardiomyocyte hypertrophy by inhibiting Beclin-1 Erratum:[Endocrine. 2020 Feb;67(2):503-505. PMID: 31939092] REFERENCE 6 (bases 1 to 76) AUTHORS Pogribny IP, Starlard-Davenport A, Tryndyak VP, Han T, Ross SA, Rusyn I and Beland FA. TITLE Difference in expression of hepatic microRNAs miR-29c, miR-34a, miR-155, and miR-200b is associated with strain-specific susceptibility to dietary nonalcoholic steatohepatitis in mice JOURNAL Lab Invest 90 (10), 1437-1446 (2010) PUBMED 20548288 REFERENCE 7 (bases 1 to 76) AUTHORS Aoi W, Naito Y, Mizushima K, Takanami Y, Kawai Y, Ichikawa H and Yoshikawa T. TITLE The microRNA miR-696 regulates PGC-1{alpha} in mouse skeletal muscle in response to physical activity JOURNAL Am J Physiol Endocrinol Metab 298 (4), E799-E806 (2010) PUBMED 20086200 REFERENCE 8 (bases 1 to 76) AUTHORS van Rooij E, Sutherland LB, Thatcher JE, DiMaio JM, Naseem RH, Marshall WS, Hill JA and Olson EN. TITLE Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis JOURNAL Proc Natl Acad Sci U S A 105 (35), 13027-13032 (2008) PUBMED 18723672 REFERENCE 9 (bases 1 to 76) AUTHORS Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R and Cuppen E. TITLE Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis JOURNAL Genome Res 16 (10), 1289-1298 (2006) PUBMED 16954537 REFERENCE 10 (bases 1 to 76) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC124507.4. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript is intronless :: SRR7345562.1695843.1, SRR7652917.971371.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-76 AC124507.4 169107-169182 FEATURES Location/Qualifiers source 1..76 /organism="Mus musculus" /mol_type="transcribed RNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="7" /map="7 69.68 cM" gene 1..76 /gene="Mir762" /gene_synonym="mir-762; Mirn762; mmu-mir-762" /note="microRNA 762" /db_xref="GeneID:791073" /db_xref="MGI:MGI:3691607" /db_xref="miRBase:MI0004215" precursor_RNA 1..76 /gene="Mir762" /gene_synonym="mir-762; Mirn762; mmu-mir-762" /product="microRNA 762" /db_xref="GeneID:791073" /db_xref="MGI:MGI:3691607" /db_xref="miRBase:MI0004215" exon 1..76 /gene="Mir762" /gene_synonym="mir-762; Mirn762; mmu-mir-762" /inference="alignment:Splign:2.1.0" ncRNA 48..69 /ncRNA_class="miRNA" /gene="Mir762" /gene_synonym="mir-762; Mirn762; mmu-mir-762" /product="mmu-miR-762" /db_xref="miRBase:MIMAT0003892" /db_xref="GeneID:791073" /db_xref="MGI:MGI:3691607" /db_xref="miRBase:MI0004215" ORIGIN
gcccggctccgggtctcggcccgcacggtccggccggccatgctggcggggctggggccgggacagagcccgtggc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]