2024-05-15 16:21:18, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_133256 1665 bp mRNA linear ROD 04-OCT-2023 DEFINITION Mus musculus GS homeobox 2 (Gsx2), mRNA. ACCESSION NM_133256 VERSION NM_133256.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1665) AUTHORS Talley MJ, Nardini D, Ehrman LA, Lu QR and Waclaw RR. TITLE Distinct requirements for Tcf3 and Tcf12 during oligodendrocyte development in the mouse telencephalon JOURNAL Neural Dev 18 (1), 5 (2023) PUBMED 37684687 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 1665) AUTHORS Hirose T, Sugitani Y, Kurihara H, Kazama H, Kusaka C, Noda T, Takahashi H and Ohno S. TITLE PAR3 restricts the expansion of neural precursor cells by regulating hedgehog signaling JOURNAL Development 149 (21) (2022) PUBMED 36218069 REFERENCE 3 (bases 1 to 1665) AUTHORS Magno L, Asgarian Z, Apanaviciute M, Milner Y, Bengoa-Vergniory N, Rubin AN and Kessaris N. TITLE Fate mapping reveals mixed embryonic origin and unique developmental codes of mouse forebrain septal neurons JOURNAL Commun Biol 5 (1), 1137 (2022) PUBMED 36302841 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 1665) AUTHORS Manuel M, Tan KB, Kozic Z, Molinek M, Marcos TS, Razak MFA, Dobolyi D, Dobie R, Henderson BEP, Henderson NC, Chan WK, Daw MI, Mason JO and Price DJ. TITLE Pax6 limits the competence of developing cerebral cortical cells to respond to inductive intercellular signals JOURNAL PLoS Biol 20 (9), e3001563 (2022) PUBMED 36067211 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 1665) AUTHORS Su-Feher L, Rubin AN, Silberberg SN, Catta-Preta R, Lim KJ, Ypsilanti AR, Zdilar I, McGinnis CS, McKinsey GL, Rubino TE Jr, Hawrylycz MJ, Thompson C, Gartner ZJ, Puelles L, Zeng H, Rubenstein JLR and Nord AS. TITLE Single cell enhancer activity distinguishes GABAergic and cholinergic lineages in embryonic mouse basal ganglia JOURNAL Proc Natl Acad Sci U S A 119 (15), e2108760119 (2022) PUBMED 35377797 REFERENCE 6 (bases 1 to 1665) AUTHORS Nagle DL, Kozak CA, Mano H, Chapman VM and Bucan M. TITLE Physical mapping of the Tec and Gabrb1 loci reveals that the Wsh mutation on mouse chromosome 5 is associated with an inversion JOURNAL Hum Mol Genet 4 (11), 2073-2079 (1995) PUBMED 8589683 REFERENCE 7 (bases 1 to 1665) AUTHORS Sommers CL, Huang K, Shores EW, Grinberg A, Charlick DA, Kozak CA and Love PE. TITLE Murine txk: a protein tyrosine kinase gene regulated by T cell activation JOURNAL Oncogene 11 (2), 245-251 (1995) PUBMED 7542761 REFERENCE 8 (bases 1 to 1665) AUTHORS Valerius MT, Li H, Stock JL, Weinstein M, Kaur S, Singh G and Potter SS. TITLE Gsh-1: a novel murine homeobox gene expressed in the central nervous system JOURNAL Dev Dyn 203 (3), 337-351 (1995) PUBMED 8589431 REFERENCE 9 (bases 1 to 1665) AUTHORS Hsieh-Li HM, Witte DP, Szucsik JC, Weinstein M, Li H and Potter SS. TITLE Gsh-2, a murine homeobox gene expressed in the developing brain JOURNAL Mech Dev 50 (2-3), 177-186 (1995) PUBMED 7619729 REFERENCE 10 (bases 1 to 1665) AUTHORS Singh G, Kaur S, Stock JL, Jenkins NA, Gilbert DJ, Copeland NG and Potter SS. TITLE Identification of 10 murine homeobox genes JOURNAL Proc Natl Acad Sci U S A 88 (23), 10706-10710 (1991) PUBMED 1683707 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AC161192.12. On Nov 17, 2006 this sequence version replaced NM_133256.1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: S79041.1, SRR7345562.4878329.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849374, SAMN01164131 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-737 AC161192.12 201741-202477 738-1665 AC161192.12 203106-204033 FEATURES Location/Qualifiers source 1..1665 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="5" /map="5 39.55 cM" gene 1..1665 /gene="Gsx2" /gene_synonym="Gsh-2; Gsh2" /note="GS homeobox 2" /db_xref="GeneID:14843" /db_xref="MGI:MGI:95843" exon 1..737 /gene="Gsx2" /gene_synonym="Gsh-2; Gsh2" /inference="alignment:Splign:2.1.0" misc_feature 107..109 /gene="Gsx2" /gene_synonym="Gsh-2; Gsh2" /note="upstream in-frame stop codon" CDS 161..1078 /gene="Gsx2" /gene_synonym="Gsh-2; Gsh2" /note="homeobox protein GSH-2; genomic screened homeo box 2; genetic-screened homeobox 2" /codon_start=1 /product="GS homeobox 2" /protein_id="NP_573555.1" /db_xref="CCDS:CCDS19350.1" /db_xref="GeneID:14843" /db_xref="MGI:MGI:95843" /translation="
MSRSFYVDSLIIKDSSRPAPSLPESHPGPDFFIPLGMPSPLVMSVSGPGCPSRKSGAFCVCPLCVTSHLHSSRPPAGAGGGATGTAGAAVAGGGVAGGTGALPLLKSQFSPAPGDAQFCPRVSHAHHHHHPPQHHHHHHQPQQPGSAAAAAAAAAAAAAAAAALGHPQHHAPVCAATTYNMSDPRRFHCLSMGGSDTSQVPNGKRMRTAFTSTQLLELEREFSSNMYLSRLRRIEIATYLNLSEKQVKIWFQNRRVKHKKEGKGASRNNHTSCKCVGSQAHYARSEDEDSLSPASANEDKEISPL"
misc_feature 503..613 /gene="Gsx2" /gene_synonym="Gsh-2; Gsh2" /note="propagated from UniProtKB/Swiss-Prot (P31316.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature order(770..784,788..790,839..841,857..859,896..898, 902..907,914..919,923..931,935..940) /gene="Gsx2" /gene_synonym="Gsh-2; Gsh2" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature order(776..778,785..787,905..907,914..919,926..928) /gene="Gsx2" /gene_synonym="Gsh-2; Gsh2" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 779..937 /gene="Gsx2" /gene_synonym="Gsh-2; Gsh2" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature 935..1075 /gene="Gsx2" /gene_synonym="Gsh-2; Gsh2" /note="propagated from UniProtKB/Swiss-Prot (P31316.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" exon 738..1665 /gene="Gsx2" /gene_synonym="Gsh-2; Gsh2" /inference="alignment:Splign:2.1.0" ORIGIN
gaggaccaaccctctccagggacccctttgttcgagtcccagacacctcagcatccccaaggacttgaccgcccgcgtgcgcccagctttccggacagtgctcagatagcagaaggagagaaggggactcagcagcccgcaggacaagccatccatcgacatgtcgcgctccttctacgtggactcactcatcatcaaggactcctcacggcccgcaccctcgctgccggaatcgcacccagggccggatttcttcatcccgctgggcatgccgtccccgttggtgatgtcagtgtccgggcctggctgtccgtcccgcaaaagcggcgctttctgcgtgtgcccgctttgcgtcacctcgcacctgcactcctctcgcccgcccgcaggagctggtggcggagctacggggaccgcgggggctgcagtggcgggcggcggggtggctggaggcaccggcgctctacctttgctcaaaagccagttctctcccgctcctggggacgcgcagttttgcccacgggtgagccacgcacaccatcaccaccacccaccacagcatcatcatcaccatcaccagccccagcagcccggctcggctgcagcggcggccgcggcggcggcggcggcagctgcggcagcggcggctctgggacacccgcagcaccacgcacctgtctgcgccgccactacctacaacatgtcggacccacggagattccactgcctctccatgggaggctccgataccagccaggtacccaatggcaaaaggatgaggacagcgtttaccagcacgcagctcctggagctggagcgagaattctcttccaatatgtacctgtcccgactccggagaatcgagatcgcgacatacctaaacctgtcagagaagcaggtgaaaatctggtttcagaaccgtcgcgtgaagcacaagaaggaggggaaaggcgcttcgaggaacaatcacacaagctgcaagtgcgtgggtagccaggcgcattatgcgcgctccgaggacgaggactccttgtcccctgcctcggctaacgaagacaaggagatttcccccttgtaaaggcagaggctccttctgctacctgctcccggtaccctgccctcctcctccccatcagcacagggaccaaagttctagtccattgccctcattccacctggaaaagaaactctgaaaagtccggggaattcaatgccgggcccgactttgaagctagctcctctttatctgggattccactcagttacggattggttttttgtttgcttttttgttgtttttaatgtaaatatctagaattctaaccagtctcatatatcaggaaaaaccagggttgattaaagtttaacactgtatggggggaggggttggttgaagacgcatgccatttgcccccctgtcttttcagaacttgatgagaagaggggtttctttattgtttttgttgttgttttaaaatgaaatcattgaagttgccattaatatagagagttaaactccgtaggtcttgttttctgaaaattttcatgggggagaattttaaatccaggtctctggaagtccctttgtatgtgaatagttttatataaaatacatatttatatttatttaaataaatgaaacgaaataaatattttttaattcgt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]