2024-05-16 01:53:17, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_010449 2250 bp mRNA linear ROD 12-SEP-2023 DEFINITION Mus musculus homeobox A1 (Hoxa1), transcript variant 1, mRNA. ACCESSION NM_010449 VERSION NM_010449.5 KEYWORDS RefSeq; RefSeq Select. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 2250) AUTHORS Petrelli B, Ozturk A, Pind M, Ayele H, Fainsod A and Hicks GG. TITLE Genetically programmed retinoic acid deficiency during gastrulation phenocopies most known developmental defects due to acute prenatal alcohol exposure in FASD JOURNAL Front Cell Dev Biol 11, 1208279 (2023) PUBMED 37397253 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 2250) AUTHORS Kessler S, Minoux M, Joshi O, Ben Zouari Y, Ducret S, Ross F, Vilain N, Salvi A, Wolff J, Kohler H, Stadler MB and Rijli FM. TITLE A multiple super-enhancer region establishes inter-TAD interactions and controls Hoxa function in cranial neural crest JOURNAL Nat Commun 14 (1), 3242 (2023) PUBMED 37277355 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 2250) AUTHORS Odelin G, Faucherre A, Marchese D, Pinard A, Jaouadi H, Le Scouarnec S, Chiarelli R, Achouri Y, Faure E, Herbane M, Theron A, Avierinos JF, Jopling C, Collod-Beroud G, Rezsohazy R and Zaffran S. CONSRTM FranceGenRef Consortium TITLE Variations in the poly-histidine repeat motif of HOXA1 contribute to bicuspid aortic valve in mouse and zebrafish JOURNAL Nat Commun 14 (1), 1543 (2023) PUBMED 36941270 REMARK GeneRIF: Variations in the poly-histidine repeat motif of HOXA1 contribute to bicuspid aortic valve in mouse and zebrafish. Publication Status: Online-Only REFERENCE 4 (bases 1 to 2250) AUTHORS Guertin TM, Palaria A, Mager J, Sandell LL, Trainor PA and Tremblay KD. TITLE Deciphering the role of retinoic acid in hepatic patterning and induction in the mouse JOURNAL Dev Biol 491, 31-42 (2022) PUBMED 36028102 REFERENCE 5 (bases 1 to 2250) AUTHORS Zhang H, Xie J, So KKH, Tong KK, Sae-Pang JJ, Wang L, Tsang SL, Chan WY, Wong EYM and Sham MH. TITLE Hoxb3 Regulates Jag1 Expression in Pharyngeal Epithelium and Affects Interaction With Neural Crest Cells JOURNAL Front Physiol 11, 612230 (2021) PUBMED 33505317 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 2250) AUTHORS Scott,M.P. TITLE Vertebrate homeobox gene nomenclature JOURNAL Cell 71 (4), 551-553 (1992) PUBMED 1358459 REFERENCE 7 (bases 1 to 2250) AUTHORS Langston AW and Gudas LJ. TITLE Identification of a retinoic acid responsive enhancer 3' of the murine homeobox gene Hox-1.6 JOURNAL Mech Dev 38 (3), 217-227 (1992) PUBMED 1360810 REFERENCE 8 (bases 1 to 2250) AUTHORS Nazarali A, Kim Y and Nirenberg M. TITLE Hox-1.11 and Hox-4.9 homeobox genes JOURNAL Proc Natl Acad Sci U S A 89 (7), 2883-2887 (1992) PUBMED 1348361 REFERENCE 9 (bases 1 to 2250) AUTHORS Chisaka O, Musci TS and Capecchi MR. TITLE Developmental defects of the ear, cranial nerves and hindbrain resulting from targeted disruption of the mouse homeobox gene Hox-1.6 JOURNAL Nature 355 (6360), 516-520 (1992) PUBMED 1346922 REFERENCE 10 (bases 1 to 2250) AUTHORS Fowlis GA, Adelman S, Knight AM and Simpson E. TITLE PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains JOURNAL Mamm Genome 3 (4), 192-196 (1992) PUBMED 1611214 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC091106.17. On Mar 18, 2023 this sequence version replaced NM_010449.4. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK083575.1, M22115.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849375, SAMN00849381 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression, longest protein ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-753 AC091106.17 30662-31414 754-2250 AC091106.17 31892-33388 FEATURES Location/Qualifiers source 1..2250 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="6" /map="6 25.4 cM" gene 1..2250 /gene="Hoxa1" /gene_synonym="ERA1; Hox-1.6" /note="homeobox A1" /db_xref="GeneID:15394" /db_xref="MGI:MGI:96170" exon 1..753 /gene="Hoxa1" /gene_synonym="ERA1; Hox-1.6" /inference="alignment:Splign:2.1.0" misc_feature 93..95 /gene="Hoxa1" /gene_synonym="ERA1; Hox-1.6" /note="upstream in-frame stop codon" CDS 99..1109 /gene="Hoxa1" /gene_synonym="ERA1; Hox-1.6" /note="isoform 1 is encoded by transcript variant 1; homeobox protein Hox-A1; early retinoic acid 1; homeobox protein Hox-1.6; homeotic protein ERA-1-993; homeoboxless protein ERA-1-399" /codon_start=1 /product="homeobox protein Hox-A1 isoform 1" /protein_id="NP_034579.3" /db_xref="CCDS:CCDS20138.1" /db_xref="GeneID:15394" /db_xref="MGI:MGI:96170" /translation="
MDNARMNSFLEYPILGSGDSGTCSARAYPSDHGITTFQSCAVSANSCGGDDRFLVGRGVQISSPHHHHHHHHHHHPQTATYQTSGNLGISYSHSSCGPSYGAQNFSAPYGPYGLNQEADVSGGYPPCAPAVYSGNLSTPMVQHHHHHQGYAGGTVGSPQYIHHSYGQEQQTLALATYNNSLSPLHASHQEACRSPASETSSPAQTFDWMKVKRNPPKTGKVGEYGYVGQPNAVRTNFTTKQLTELEKEFHFNKYLTRARRVEIAASLQLNETQVKIWFQNRRMKQKKREKEGLLPISPATPPGSDEKTEESSEKSSPSPSAPSPASSTSDTLTTSH"
misc_feature 627..>959 /gene="Hoxa1" /gene_synonym="ERA1; Hox-1.6" /note="Homeodomain-containing transcription factor [Transcription]; Region: COG5576" /db_xref="CDD:227863" misc_feature order(798..803,807..809,858..860,876..878,915..917, 921..926,933..938,942..950,954..959) /gene="Hoxa1" /gene_synonym="ERA1; Hox-1.6" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 798..956 /gene="Hoxa1" /gene_synonym="ERA1; Hox-1.6" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(804..806,924..926,933..938,945..947) /gene="Hoxa1" /gene_synonym="ERA1; Hox-1.6" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" exon 754..2250 /gene="Hoxa1" /gene_synonym="ERA1; Hox-1.6" /inference="alignment:Splign:2.1.0" ORIGIN
gtacattcatatcatttttcttctctggtcctatggaggaagtgagaaagttggcacggtcacccagggcttcgcaggatccaatcactcagtgacagatggacaatgcaagaatgaactcctttctggaataccccatccttggcagtggcgactctgggacctgctcggcgcgagcttacccctctgaccatgggattacaactttccaatcctgcgcggtcagtgccaacagctgcggcggcgacgaccgcttcctagtgggcaggggggtgcagatcagctcgccccaccaccaccaccaccaccaccaccatcaccacccccagacggctacttaccagacttctggaaaccttgggatttcttattcccactcgagttgtggtccaagctatggcgcgcagaacttcagtgcgccttatggcccctatggattaaatcaggaagcagacgtaagtggtgggtaccccccgtgcgctcccgctgtttactctggaaacctctcgactcccatggtccagcatcaccaccaccaccagggttatgctgggggcacagtgggctcgccccagtacattcaccactcatatggacaagagcagcagactctggccctggccacgtataataactccttatcccctctccacgccagccaccaagaagcctgtcgttcccctgcttcagagacgtcttctccagcgcagacctttgactggatgaaagttaaaagaaaccctcccaaaacagggaaagttggagagtacggctacgtgggtcaacccaacgcagtgcgcaccaatttcaccaccaagcagctcacagagctggagaaggagttccacttcaacaagtaccttacacgagcgcgcagggtggagattgccgcgtccctacagctcaatgagacccaggtgaagatctggttccagaatcgccgcatgaagcagaagaagcgtgagaaggaggggctcctgcccatctcccctgccactcctcctggcagcgatgagaaaacggaagaatcatctgagaaatctagcccctcgcccagtgccccttctccggcatcgtctacctcagacactctgactacctcccactgaggctactccagcccaactctgcagcccaggcttctccctgggctgggatttcttacccaaagcacattcttagcttatcttcctttctttacagactctctcttcctttctcgtcccatctggggagctcctggccaagataaggtatttccagagaattctggagccttggttggaagttaactccttcatccacatcgggtgtccacatcaattgctgatggctcccaacatcctttccttcactgttgtgagatttttttctccccacaacctatgattccttttagatgtcggctggagaacagttagttccctttgccatcagacatttgcaggaaggaggcatctctccttttatctatgtattgttcttctccacctagcccttaagtaggacatagaggagagagagtgtccaaagactcatgaagaagagatgcactgtgtttacacaattaattcaccccctaacttagctggtttcatgtgtgtgagtttgctggttgtaaatgctttcccgtcagagatttatctttatacacattttatagaaatatgtaggtcactaaatcaaacagggtggacaaattctcaaaactggtacagttcatgtgtgattatgggcgaaagaagaaaacctctttcattcaaacagagtcagatgcctcagaagttggcctcaattggttctttcagagttaagaaggcctgccaagcactttgcctgtgccaggtcttcccaaactctaaccaattcttcctgcttctctggccaccctgcatttaaaaatcatgctggatcatttgtaacccaaaggtattcattctttcagtcaccctttccttccacactgtcttgtatcatggctggatccagtgtatttccagctaattgttaatgtgatggatggcacaatgaatgtatattttgtgtgattcgtgactagtcttctgcatgtcgcacaatgttctgatgtccctgaaatatcacactgagttctatcagttattctttgtgagcctatgatagtctccatttactgtacaatcatgaacagctctgagatcctggagtgatgtggtccagagcagagtttacgggtcttaagatgtctgtaataaaagtattcaagtttta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]