GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-15 13:05:29, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_009116               1152 bp    mRNA    linear   ROD 28-MAY-2023
DEFINITION  Mus musculus paired related homeobox 2 (Prrx2), mRNA.
ACCESSION   NM_009116 XM_979268
VERSION     NM_009116.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1152)
  AUTHORS   Li Y, Wang X, Pan C, Yuan H, Li X, Chen Z and He H.
  TITLE     Myoblast-derived exosomal Prrx2 attenuates osteoporosis via
            transcriptional regulation of lncRNA-MIR22HG to activate Hippo
            pathway
  JOURNAL   Mol Med 29 (1), 54 (2023)
   PUBMED   37081396
  REMARK    GeneRIF: Myoblast-derived exosomal Prrx2 attenuates osteoporosis
            via transcriptional regulation of lncRNA-MIR22HG to activate Hippo
            pathway.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1152)
  AUTHORS   Jang YS, Lee YS, Kim DH, Oh GT, Jeon WK and Han JS.
  TITLE     Peroxiredoxin 2 deletion impairs hippocampal-dependent memory via
            exacerbating transient ischemia-induced oxidative damage
  JOURNAL   Brain Res Bull 184, 99-105 (2022)
   PUBMED   35452748
  REMARK    GeneRIF: Peroxiredoxin 2 deletion impairs hippocampal-dependent
            memory via exacerbating transient ischemia-induced oxidative
            damage.
REFERENCE   3  (bases 1 to 1152)
  AUTHORS   Gamart J, Barozzi I, Laurent F, Reinhardt R, Martins LR, Oberholzer
            T, Visel A, Zeller R and Zuniga A.
  TITLE     SMAD4 target genes are part of a transcriptional network that
            integrates the response to BMP and SHH signaling during early limb
            bud patterning
  JOURNAL   Development 148 (23) (2021)
   PUBMED   34822715
REFERENCE   4  (bases 1 to 1152)
  AUTHORS   Yin Y, Haller ME, Chadchan SB, Kommagani R and Ma L.
  TITLE     Signaling through retinoic acid receptors is essential for
            mammalian uterine receptivity and decidualization
  JOURNAL   JCI Insight 6 (17), e150254 (2021)
   PUBMED   34292881
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1152)
  AUTHORS   Funada K, Yoshizaki K, MIyazaki K, Han X, Yuta T, Tian T, Mizuta K,
            Fu Y, Iwamoto T, Yamada A, Takahashi I and Fukumoto S.
  TITLE     microRNA-875-5p plays critical role for mesenchymal condensation in
            epithelial-mesenchymal interaction during tooth development
  JOURNAL   Sci Rep 10 (1), 4918 (2020)
   PUBMED   32188878
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1152)
  AUTHORS   Leussink B, Brouwer A, el Khattabi M, Poelmann RE, Gittenberger-de
            Groot AC and Meijlink F.
  TITLE     Expression patterns of the paired-related homeobox genes MHox/Prx1
            and S8/Prx2 suggest roles in development of the heart and the
            forebrain
  JOURNAL   Mech Dev 52 (1), 51-64 (1995)
   PUBMED   7577675
REFERENCE   7  (bases 1 to 1152)
  AUTHORS   de Jong R and Meijlink F.
  TITLE     The homeobox gene S8: mesoderm-specific expression in presomite
            embryos and in cells cultured in vitro and modulation in
            differentiating pluripotent cells
  JOURNAL   Dev Biol 157 (1), 133-146 (1993)
   PUBMED   7683282
REFERENCE   8  (bases 1 to 1152)
  AUTHORS   Haas IG, Simon-Chazottes D and Guenet JL.
  TITLE     The gene coding for the immunoglobulin heavy chain binding protein
            BiP (Hsce-70) maps to mouse chromosome 2
  JOURNAL   Mamm Genome 3 (11), 659-660 (1992)
   PUBMED   1450517
REFERENCE   9  (bases 1 to 1152)
  AUTHORS   Opstelten DJ, Vogels R, Robert B, Kalkhoven E, Zwartkruis F, de
            Laaf L, Destree OH, Deschamps J, Lawson KA and Meijlink F.
  TITLE     The mouse homeobox gene, S8, is expressed during embryogenesis
            predominantly in mesenchyme
  JOURNAL   Mech Dev 34 (1), 29-41 (1991)
   PUBMED   1680375
REFERENCE   10 (bases 1 to 1152)
  AUTHORS   Kongsuwan K, Webb E, Housiaux P and Adams JM.
  TITLE     Expression of multiple homeobox genes within diverse mammalian
            haemopoietic lineages
  JOURNAL   EMBO J 7 (7), 2131-2138 (1988)
   PUBMED   2901346
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL844532.18.
            
            On Dec 22, 2022 this sequence version replaced NM_009116.2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: X52875.1, BC137874.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849374, SAMN00849375
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-338               AL844532.18        76355-76692
            339-520             AL844532.18        109421-109602
            521-699             AL844532.18        110503-110681
            700-1152            AL844532.18        111806-112258
FEATURES             Location/Qualifiers
     source          1..1152
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="2"
                     /map="2 21.74 cM"
     gene            1..1152
                     /gene="Prrx2"
                     /gene_synonym="Prx2; S8"
                     /note="paired related homeobox 2"
                     /db_xref="GeneID:20204"
                     /db_xref="MGI:MGI:98218"
     exon            1..338
                     /gene="Prrx2"
                     /gene_synonym="Prx2; S8"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    47..49
                     /gene="Prrx2"
                     /gene_synonym="Prx2; S8"
                     /note="upstream in-frame stop codon"
     CDS             92..835
                     /gene="Prrx2"
                     /gene_synonym="Prx2; S8"
                     /note="PRX-2; homeobox protein S8; homeo box of paired
                     rule; surface antigen, homeo box of paired rule"
                     /codon_start=1
                     /product="paired mesoderm homeobox protein 2"
                     /protein_id="NP_033142.2"
                     /db_xref="CCDS:CCDS15888.1"
                     /db_xref="GeneID:20204"
                     /db_xref="MGI:MGI:98218"
                     /translation="
MDSAAAAFALDPPAPGPGPPPAPGDCAQARKNFSVSHLLDLEEVAAAGRRAAGPVSGPAEAREGAAREPSGGSSGSEAAPQDGDCPSPGRGTKRKKKQRRNRTTFNSSQLQALERVFERTHYPDAFVREELARRVNLSEARVQVWFQNRRAKFRRNERAMLATRSASLLKSYGQEAAIEQPVAPRPTTMSPDYLSWPASSPYSSVPPYSPGGSSPATPGVNMANSIASLRLKAKEFSLHHSQVPTVN"
     misc_feature    92..184
                     /gene="Prrx2"
                     /gene_synonym="Prx2; S8"
                     /note="propagated from UniProtKB/Swiss-Prot (Q06348.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    236..412
                     /gene="Prrx2"
                     /gene_synonym="Prx2; S8"
                     /note="propagated from UniProtKB/Swiss-Prot (Q06348.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    398..553
                     /gene="Prrx2"
                     /gene_synonym="Prx2; S8"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(401..403,521..523,530..535,542..544)
                     /gene="Prrx2"
                     /gene_synonym="Prx2; S8"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    <416..730
                     /gene="Prrx2"
                     /gene_synonym="Prx2; S8"
                     /note="Homeodomain-containing transcription factor
                     [Transcription]; Region: COG5576"
                     /db_xref="CDD:227863"
     misc_feature    752..802
                     /gene="Prrx2"
                     /gene_synonym="Prx2; S8"
                     /note="OAR domain; Region: OAR; pfam03826"
                     /db_xref="CDD:427530"
     misc_feature    761..802
                     /gene="Prrx2"
                     /gene_synonym="Prx2; S8"
                     /note="propagated from UniProtKB/Swiss-Prot (Q06348.2);
                     Region: OAR.
                     /evidence=ECO:0000255|PROSITE-ProRule:PRU00138"
     exon            339..520
                     /gene="Prrx2"
                     /gene_synonym="Prx2; S8"
                     /inference="alignment:Splign:2.1.0"
     exon            521..699
                     /gene="Prrx2"
                     /gene_synonym="Prx2; S8"
                     /inference="alignment:Splign:2.1.0"
     exon            700..1152
                     /gene="Prrx2"
                     /gene_synonym="Prx2; S8"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    755..802
                     /gene="Prrx2"
                     /gene_synonym="Prx2; S8"
                     /note="aristaless-domain"
ORIGIN      
gcagaaagttcgggtccccgaccgactgacttgagatccggcacagtgagcagcgggaggcggcggcggccggcagaggcgcggccagggcatggacagcgcggccgccgccttcgccctagacccgccagcgcccggcccggggcccccgcccgcacccggcgattgcgcccaggcgcgcaagaacttctcggtgagccacctcctggacctggaggaggtggcggctgctgggcgcagggctgcggggcccgtttcggggcccgccgaggcgcgggagggagcggcgcgcgaaccgtccgggggcagcagcggcagcgaggcggcgccgcaggacggtgactgtcccagccccggccgtggcaccaaacgaaagaagaagcagcgccggaatcgaaccacattcaacagcagccagctgcaggcgctggagcgtgtatttgagcgcacacactaccctgacgcctttgtgcgtgaagagctagctcgccgtgtcaacctcagtgaggcacgtgtccaagtctggttccagaaccgccgtgccaagtttcgccggaatgaacgtgccatgctggctacccgctctgcctcgttgctcaagtcttatggccaggaggcggccattgaacagcctgtggccccccgacctaccacgatgagcccagattatctatcctggccagcatcctccccctacagctccgtgcctccctatagccccggaggttcaagtcctgcaactcctggagtcaacatggccaacagcatcgccagccttcgcctcaaggccaaagagttcagcctacaccacagccaggtgcccacagtgaactgactgtgcattgggtccagcttcctccctggcccaatggcagactgcagcaaaggcagtagccttgtctgtctctgtcctcagacaaactgggcagcctctcccgtgccttttctccatcacagcttcctgagttccagaggcctgttgggtgctggaagcagttgaacaagtcactgctatggtggctgagattgtggcctaaggcccctggagtggcctggccagaaggcggagctggagtccgccaaggaactcacttacttatgtattaaaaccaaaaagcttttgtctttaaggaataaaaccatttttcgtaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]