2024-05-15 14:35:53, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_009095 733 bp mRNA linear ROD 08-AUG-2023 DEFINITION Mus musculus ribosomal protein S5 (Rps5), transcript variant 2, mRNA. ACCESSION NM_009095 VERSION NM_009095.3 KEYWORDS RefSeq; RefSeq Select. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 733) AUTHORS Li H, Huo Y, He X, Yao L, Zhang H, Cui Y, Xiao H, Xie W, Zhang D, Wang Y, Zhang S, Tu H, Cheng Y, Guo Y, Cao X, Zhu Y, Jiang T, Guo X, Qin Y and Sha J. TITLE A male germ-cell-specific ribosome controls male fertility JOURNAL Nature 612 (7941), 725-731 (2022) PUBMED 36517592 REFERENCE 2 (bases 1 to 733) AUTHORS Harnett D, Ambrozkiewicz MC, Zinnall U, Rusanova A, Borisova E, Drescher AN, Couce-Iglesias M, Villamil G, Dannenberg R, Imami K, Munster-Wandowski A, Fauler B, Mielke T, Selbach M, Landthaler M, Spahn CMT, Tarabykin V, Ohler U and Kraushar ML. TITLE A critical period of translational control during brain development at codon resolution JOURNAL Nat Struct Mol Biol 29 (12), 1277-1290 (2022) PUBMED 36482253 REFERENCE 3 (bases 1 to 733) AUTHORS Zhang M, Chen D, Xia J, Han W, Cui X, Neuenkirchen N, Hermes G, Sestan N and Lin H. TITLE Post-transcriptional regulation of mouse neurogenesis by Pumilio proteins JOURNAL Genes Dev 31 (13), 1354-1369 (2017) PUBMED 28794184 REFERENCE 4 (bases 1 to 733) AUTHORS Vizirianakis IS, Papachristou ET, Andreadis P, Zopounidou E, Matragkou CN and Tsiftsoglou AS. TITLE Genetic manipulation of RPS5 gene expression modulates the initiation of commitment of MEL cells to erythroid maturation: Implications in understanding ribosomopathies JOURNAL Int J Oncol 47 (1), 303-314 (2015) PUBMED 25998414 REMARK GeneRIF: Findings support the concept that genetic manipulation of RPS5 gene expression level (up- and/or downregulation) critically affects the potential of murine erythroleukemia cells to fully complete their erythroid maturation program in vitro. REFERENCE 5 (bases 1 to 733) AUTHORS Khatter H, Myasnikov AG, Natchiar SK and Klaholz BP. TITLE Structure of the human 80S ribosome JOURNAL Nature 520 (7549), 640-645 (2015) PUBMED 25901680 REFERENCE 6 (bases 1 to 733) AUTHORS Stryke D, Kawamoto M, Huang CC, Johns SJ, King LA, Harper CA, Meng EC, Lee RE, Yee A, L'Italien L, Chuang PT, Young SG, Skarnes WC, Babbitt PC and Ferrin TE. TITLE BayGenomics: a resource of insertional mutations in mouse embryonic stem cells JOURNAL Nucleic Acids Res 31 (1), 278-281 (2003) PUBMED 12520002 REFERENCE 7 (bases 1 to 733) AUTHORS Reymond A, Marigo V, Yaylaoglu MB, Leoni A, Ucla C, Scamuffa N, Caccioppoli C, Dermitzakis ET, Lyle R, Banfi S, Eichele G, Antonarakis SE and Ballabio A. TITLE Human chromosome 21 gene expression atlas in the mouse JOURNAL Nature 420 (6915), 582-586 (2002) PUBMED 12466854 REFERENCE 8 (bases 1 to 733) AUTHORS Pfisterer P, Ehlermann J, Hegen M and Schorle H. TITLE A subtractive gene expression screen suggests a role of transcription factor AP-2 alpha in control of proliferation and differentiation JOURNAL J Biol Chem 277 (8), 6637-6644 (2002) PUBMED 11741941 REFERENCE 9 (bases 1 to 733) AUTHORS Vizirianakis IS, Pappas IS, Gougoumas D and Tsiftsoglou AS. TITLE Expression of ribosomal protein S5 cloned gene during differentiation and apoptosis in murine erythroleukemia (MEL) cells JOURNAL Oncol Res 11 (9), 409-419 (1999) PUBMED 10821535 REFERENCE 10 (bases 1 to 733) AUTHORS Vanegas N, Castaneda V, Santamaria D, Hernandez P, Schvartzman JB and Krimer DB. TITLE Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5 JOURNAL Biochim Biophys Acta 1357 (1), 1-4 (1997) PUBMED 9202169 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC107704.8. On Mar 1, 2023 this sequence version replaced NM_009095.2. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: CA461462.1, CA787280.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849374, SAMN00849375 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression, longest protein ##RefSeq-Attributes-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-71 AC107704.8 141288-141358 72-180 AC107704.8 141943-142051 181-390 AC107704.8 144362-144571 391-519 AC107704.8 144707-144835 520-618 AC107704.8 145366-145464 619-733 AC107704.8 145542-145656 FEATURES Location/Qualifiers source 1..733 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="7" /map="7 7.69 cM" gene 1..733 /gene="Rps5" /note="ribosomal protein S5" /db_xref="GeneID:20103" /db_xref="MGI:MGI:1097682" exon 1..71 /gene="Rps5" /inference="alignment:Splign:2.1.0" exon 72..180 /gene="Rps5" /inference="alignment:Splign:2.1.0" CDS 73..687 /gene="Rps5" /note="40S ribosomal protein S5; S5 ribosomal protein" /codon_start=1 /product="small ribosomal subunit protein uS7" /protein_id="NP_033121.2" /db_xref="CCDS:CCDS20817.1" /db_xref="GeneID:20103" /db_xref="MGI:MGI:1097682" /translation="
MTEWEAATPAVAETPDIKLFGKWSTDDVQINDISLQDYIAVKEKYAKYLPHSAGRYAAKRFRKAQCPIVERLTNSMMMHGRNNGKKLMTVRIVKHAFEIIHLLTGENPLQVLVNAIINSGPREDSTRIGRAGTVRRQAVDVSPLRRVNQAIWLLCTGAREAAFRNIKTIAECLADELINAAKGSSNSYAIKKKDELERVAKSNR"
misc_feature 73..75 /gene="Rps5" /note="N-acetylmethionine. /evidence=ECO:0000250|UniProtKB:P46782; propagated from UniProtKB/Swiss-Prot (P97461.4); acetylation site" misc_feature 76..78 /gene="Rps5" /note="N-acetylthreonine, in 40S ribosomal protein S5, N-terminally processed. /evidence=ECO:0000250|UniProtKB:P46782; propagated from UniProtKB/Swiss-Prot (P97461.4); acetylation site" misc_feature 112..114 /gene="Rps5" /note="Phosphothreonine. /evidence=ECO:0000250|UniProtKB:P46782; propagated from UniProtKB/Swiss-Prot (P97461.4); phosphorylation site" misc_feature 124..684 /gene="Rps5" /note="Eukaryota homolog of Ribosomal Protein S7; Region: uS7_Eukaryote; cd14867" /db_xref="CDD:271246" misc_feature order(124..126,211..219,223..234,331..333,343..345) /gene="Rps5" /note="S9 interface [polypeptide binding]; other site" /db_xref="CDD:271246" misc_feature 211..213 /gene="Rps5" /note="N6-acetyllysine, alternate. /evidence=ECO:0007744|PubMed:23806337; propagated from UniProtKB/Swiss-Prot (P97461.4); acetylation site" misc_feature order(223..225,229..231,241..252,259..261,283..285, 292..294,298..312,322..336,343..345,463..471,475..477, 505..507,526..528,547..549,556..558,574..579) /gene="Rps5" /note="rRNA binding site [nucleotide binding]; other site" /db_xref="CDD:271246" misc_feature order(355..357,364..369,376..378,574..576,580..585) /gene="Rps5" /note="S25 interface [polypeptide binding]; other site" /db_xref="CDD:271246" misc_feature order(460..462,469..471,475..477,682..684) /gene="Rps5" /note="S11 interface [polypeptide binding]; other site" /db_xref="CDD:271246" misc_feature 496..498 /gene="Rps5" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:P46782; propagated from UniProtKB/Swiss-Prot (P97461.4); phosphorylation site" exon 181..390 /gene="Rps5" /inference="alignment:Splign:2.1.0" exon 391..519 /gene="Rps5" /inference="alignment:Splign:2.1.0" exon 520..618 /gene="Rps5" /inference="alignment:Splign:2.1.0" exon 619..733 /gene="Rps5" /inference="alignment:Splign:2.1.0" ORIGIN
ctcttcctgtctgtatcagggcggcgcgtggtccacgccgagcgactgagaagcccagtctgcgccctcaggatgactgagtgggaagcagccacaccagcggtggcagagacccctgacatcaagctctttgggaaatggagcactgatgacgtgcagatcaacgatatttctctgcaggattacattgctgtgaaggagaagtatgccaagtacctgccccacagtgccggacggtatgctgccaagcgcttccgcaaagcacaatgtcccatcgtggagcgccttactaactccatgatgatgcatggtcgtaacaacggcaagaagctcatgactgtgcgaattgtcaagcatgcctttgagatcatccacctgctcactggtgagaaccctctgcaggtcctggtgaatgctatcatcaacagtggcccccgagaagactcaacacgcattgggcgggccggtacagtgagacgacaggctgtggatgtgtccccactgcgtcgagtgaatcaggccatctggctgctgtgcacaggggctcgtgaggctgctttccggaacatcaagaccatcgccgagtgccttgcagatgagctcattaatgctgccaagggctcctccaattcctatgccatcaagaagaaagatgaactggagcgtgtggccaagtctaaccgctgatttcccagctgctgcctaataaactgtgtcctttggaacaactata
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]