GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-19 16:06:25, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_047447058             531 bp    mRNA    linear   PRI 05-OCT-2023
DEFINITION  PREDICTED: Homo sapiens putative double homeobox protein 3
            (LOC124908437), mRNA.
ACCESSION   XM_047447058
VERSION     XM_047447058.1
DBLINK      BioProject: PRJNA807723
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_060946) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_009914755.1-RS_2023_10
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 10/02/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..531
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /isolate="CHM13"
                     /db_xref="taxon:9606"
                     /chromosome="22"
                     /sex="female"
                     /cell_line="CHM13htert"
                     /tissue_type="hydatidiform mole"
                     /note="haploid cell line"
     gene            1..531
                     /gene="LOC124908437"
                     /note="putative double homeobox protein 3; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 2 Proteins"
                     /db_xref="GeneID:124908437"
     CDS             1..531
                     /gene="LOC124908437"
                     /codon_start=1
                     /product="putative double homeobox protein 3"
                     /protein_id="XP_047303014.1"
                     /db_xref="GeneID:124908437"
                     /translation="
MPAEVHGSPPASLCPCPSVKFRPGLPAMALLTALDDTLPEEAQGPGRRMILLSTPSQSDALRACFERNLYPGIATKEQLAQGIDIPEPRVQIWFQNERSCQLRQHRRQSRPWPGRRDPQKGRRKRTAITGSQTALLLRAFEKDRFPGIAAREELARETGLPESRIQIWFQNRRARH"
     misc_feature    160..297
                     /gene="LOC124908437"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cl00084"
                     /db_xref="CDD:444687"
     misc_feature    order(364..378,382..384,433..435,451..453,490..492,
                     496..501,508..513,517..525)
                     /gene="LOC124908437"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    370..528
                     /gene="LOC124908437"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(370..372,379..381,499..501,508..513,520..522)
                     /gene="LOC124908437"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
ORIGIN      
atgccggctgaggtgcacgggagcccgcccgcctctctctgcccgtgtccgtccgtgaaattccggccggggctccctgcgatggccctcctgacagctttggacgacaccctccccgaggaagcccagggaccgggaaggcgaatgatactcctttcgaccccgagtcaaagcgatgccctgcgagcctgctttgagcggaacctgtacccgggcattgccaccaaagaacagctggcccagggcatcgacattccggagcccagggtccagatttggtttcagaatgagagatcatgccagttgaggcagcaccggcggcaatctcggccctggcccgggagacgcgacccgcaaaaaggcagacgaaagcggactgccatcaccggatcccaaaccgccctgctcctccgagcctttgagaaggatcgctttccaggcattgctgccagggaagagctggccagagagacgggcctcccggagtccaggattcagatctggtttcagaatcgaagagccaggcactga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]