LOCUS       NR_039956                 87 bp    RNA     linear   PRI 30-JAN-2022
DEFINITION  Homo sapiens microRNA 4793 (MIR4793), microRNA.
ACCESSION   NR_039956
VERSION     NR_039956.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 87)
  AUTHORS   Yan M, Niu L, Liu J, Yao Y and Li H.
  TITLE     circEVI5 acts as a miR-4793-3p sponge to suppress the proliferation
            of gastric cancer
  JOURNAL   Cell Death Dis 12 (8), 774 (2021)
   PUBMED   34354043
  REMARK    GeneRIF: circEVI5 acts as a miR-4793-3p sponge to suppress the
            proliferation of gastric cancer.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 87)
  AUTHORS   Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L,
            Loman N, Jonsson G, Naya H, Hoglund M, Borg A and Rovira C.
  TITLE     Identification of new microRNAs in paired normal and tumor breast
            tissue suggests a dual role for the ERBB2/Her2 gene
  JOURNAL   Cancer Res 71 (1), 78-86 (2011)
   PUBMED   21199797
REFERENCE   3  (bases 1 to 87)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC121252.4.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-87                AC121252.4         82642-82728         c
FEATURES             Location/Qualifiers
     source          1..87
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3p21.31"
     gene            1..87
                     /gene="MIR4793"
                     /note="microRNA 4793"
                     /db_xref="GeneID:100616112"
                     /db_xref="HGNC:HGNC:41538"
                     /db_xref="miRBase:MI0017440"
     precursor_RNA   1..87
                     /gene="MIR4793"
                     /product="microRNA 4793"
                     /db_xref="GeneID:100616112"
                     /db_xref="HGNC:HGNC:41538"
                     /db_xref="miRBase:MI0017440"
     exon            1..87
                     /gene="MIR4793"
                     /inference="alignment:Splign:2.1.0"
     variation       6
                     /gene="MIR4793"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2047058793"
     variation       9
                     /gene="MIR4793"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764995199"
     variation       10
                     /gene="MIR4793"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761647376"
     variation       11
                     /gene="MIR4793"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2047058217"
     variation       13
                     /gene="MIR4793"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776757428"
     variation       15
                     /gene="MIR4793"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1488955294"
     variation       16
                     /gene="MIR4793"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373490754"
     variation       17
                     /gene="MIR4793"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775646965"
     variation       18
                     /gene="MIR4793"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:772276217"
     ncRNA           19..42
                     /ncRNA_class="miRNA"
                     /gene="MIR4793"
                     /product="hsa-miR-4793-5p"
                     /db_xref="miRBase:MIMAT0019965"
                     /db_xref="GeneID:100616112"
                     /db_xref="HGNC:HGNC:41538"
                     /db_xref="miRBase:MI0017440"
     variation       29
                     /gene="MIR4793"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2047058011"
     variation       30
                     /gene="MIR4793"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138052127"
     variation       32
                     /gene="MIR4793"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779453089"
     variation       33
                     /gene="MIR4793"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2047057931"
     variation       34
                     /gene="MIR4793"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2106701526"
     variation       36
                     /gene="MIR4793"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213116185"
     variation       37
                     /gene="MIR4793"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370939789"
     variation       38
                     /gene="MIR4793"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749627418"
     variation       39
                     /gene="MIR4793"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780847102"
     variation       44
                     /gene="MIR4793"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754564648"
     variation       45
                     /gene="MIR4793"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560454528"
     variation       47
                     /gene="MIR4793"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2106701499"
     variation       50
                     /gene="MIR4793"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1449029134"
     variation       54
                     /gene="MIR4793"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2047056812"
     variation       57
                     /gene="MIR4793"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359588980"
     ncRNA           58..80
                     /ncRNA_class="miRNA"
                     /gene="MIR4793"
                     /product="hsa-miR-4793-3p"
                     /db_xref="miRBase:MIMAT0019966"
                     /db_xref="GeneID:100616112"
                     /db_xref="HGNC:HGNC:41538"
                     /db_xref="miRBase:MI0017440"
     variation       61
                     /gene="MIR4793"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1575539289"
     variation       63
                     /gene="MIR4793"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779602935"
     variation       64
                     /gene="MIR4793"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757908486"
     variation       65
                     /gene="MIR4793"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2047056678"
     variation       72
                     /gene="MIR4793"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1422853760"
     variation       75
                     /gene="MIR4793"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2047056635"
     variation       76
                     /gene="MIR4793"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2047056615"
     variation       80
                     /gene="MIR4793"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377721296"
     variation       81
                     /gene="MIR4793"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426193549"
     variation       82
                     /gene="MIR4793"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765189900"
     variation       85
                     /gene="MIR4793"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761542012"
ORIGIN      

tttctcctcgctgcccgcacatcctgctccacagggcagagggaggccaagaagacctctgcactgtgagttggctggctggaggaa

//