2024-05-19 16:59:18, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_039601 96 bp RNA linear PRI 22-AUG-2022 DEFINITION Homo sapiens microRNA 151b (MIR151B), microRNA. ACCESSION NR_039601 VERSION NR_039601.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 96) AUTHORS Dong Q, Dong L, Zhu Y, Wang X, Li Z and Zhang L. TITLE Circular ribonucleic acid nucleoporin 98 knockdown alleviates high glucose-induced proliferation, fibrosis, inflammation and oxidative stress in human glomerular mesangial cells by regulating the microribonucleic acid-151-3p-high mobility group AT-hook 2 axis JOURNAL J Diabetes Investig 13 (8), 1303-1315 (2022) PUBMED 35482475 REMARK GeneRIF: Circular ribonucleic acid nucleoporin 98 knockdown alleviates high glucose-induced proliferation, fibrosis, inflammation and oxidative stress in human glomerular mesangial cells by regulating the microribonucleic acid-151-3p-high mobility group AT-hook 2 axis. REFERENCE 2 (bases 1 to 96) AUTHORS Huang K, Liu D and Su C. TITLE Circ_0007841 accelerates ovarian cancer development through facilitating MEX3C expression by restraining miR-151-3p activity JOURNAL Aging (Albany NY) 13 (8), 12058-12066 (2021) PUBMED 33896797 REMARK GeneRIF: Circ_0007841 accelerates ovarian cancer development through facilitating MEX3C expression by restraining miR-151-3p activity. REFERENCE 3 (bases 1 to 96) AUTHORS Cheng X, Kan P, Ma Z, Wang Y, Song W, Huang C and Zhang B. TITLE Exploring the potential value of miR-148b-3p, miR-151b and miR-27b-3p as biomarkers in acute ischemic stroke JOURNAL Biosci Rep 38 (6) (2018) PUBMED 30361294 REMARK GeneRIF: Blood miR-151b level was negatively correlated with insulin-like growth factor-1 (IGF-1), and miR-27b-3p level was negatively correlated with IGF-1 and insulin-like growth factor binding protein-3, respectively. Our findings suggest that miR-148b-3p, miR-151b and miR-27b-3p may serve as blood-based biomarkers for diagnosing ischemic stroke patients, and the combination of miR-148b-3p and miR-27b-3p may be more powerful Publication Status: Online-Only REFERENCE 4 (bases 1 to 96) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 96) AUTHORS Kaudewitz D, Skroblin P, Bender LH, Barwari T, Willeit P, Pechlaner R, Sunderland NP, Willeit K, Morton AC, Armstrong PC, Chan MV, Lu R, Yin X, Gracio F, Dudek K, Langley SR, Zampetaki A, de Rinaldis E, Ye S, Warner TD, Saxena A, Kiechl S, Storey RF and Mayr M. TITLE Association of MicroRNAs and YRNAs With Platelet Function JOURNAL Circ Res 118 (3), 420-432 (2016) PUBMED 26646931 REFERENCE 6 (bases 1 to 96) AUTHORS Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Liu Q, How T, Grubor V, Gao Y, Patel A, Wu H, Zhu J, Blobe GC, Lipsky PE, Chadburn A and Dave SS. CONSRTM Hematologic Malignancies Research Consortium TITLE Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs JOURNAL Blood 116 (23), e118-e127 (2010) PUBMED 20733160 REFERENCE 7 (bases 1 to 96) AUTHORS Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R and Cuppen E. TITLE Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis JOURNAL Genome Res 16 (10), 1289-1298 (2006) PUBMED 16954537 REFERENCE 8 (bases 1 to 96) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AL133523.5. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-96 AL133523.5 46944-47039 c FEATURES Location/Qualifiers source 1..96 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="14" /map="14q32.2" gene 1..96 /gene="MIR151B" /note="microRNA 151b" /db_xref="GeneID:100616247" /db_xref="HGNC:HGNC:41588" /db_xref="miRBase:MI0003772" precursor_RNA 1..96 /gene="MIR151B" /product="microRNA 151b" /db_xref="GeneID:100616247" /db_xref="HGNC:HGNC:41588" /db_xref="miRBase:MI0003772" exon 1..96 /gene="MIR151B" /inference="alignment:Splign:2.1.0" variation 2 /gene="MIR151B" /replace="c" /replace="t" /db_xref="dbSNP:1185548105" variation 4 /gene="MIR151B" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1448738453" variation 10 /gene="MIR151B" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1262359333" variation 12 /gene="MIR151B" /replace="g" /replace="gg" /db_xref="dbSNP:1886809302" variation 15 /gene="MIR151B" /replace="a" /replace="aa" /db_xref="dbSNP:1326987127" variation 15 /gene="MIR151B" /replace="a" /replace="g" /db_xref="dbSNP:1204545537" variation 16 /gene="MIR151B" /replace="c" /replace="g" /db_xref="dbSNP:1886808507" variation 17 /gene="MIR151B" /replace="c" /replace="t" /db_xref="dbSNP:1274854663" variation 18 /gene="MIR151B" /replace="c" /replace="t" /db_xref="dbSNP:1025717145" variation 20 /gene="MIR151B" /replace="c" /replace="t" /db_xref="dbSNP:1566702830" variation 22 /gene="MIR151B" /replace="c" /replace="t" /db_xref="dbSNP:1886807559" variation 34 /gene="MIR151B" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:544043099" variation 35 /gene="MIR151B" /replace="a" /replace="g" /db_xref="dbSNP:1290986494" variation 41 /gene="MIR151B" /replace="c" /replace="g" /db_xref="dbSNP:1432305247" variation 42 /gene="MIR151B" /replace="a" /replace="c" /db_xref="dbSNP:1886806849" variation 49 /gene="MIR151B" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1326567589" variation 53..61 /gene="MIR151B" /replace="" /replace="cctgccctc" /db_xref="dbSNP:1566702802" variation 53 /gene="MIR151B" /replace="c" /replace="t" /db_xref="dbSNP:1317020330" variation 57 /gene="MIR151B" /replace="c" /replace="t" /db_xref="dbSNP:920667244" variation 58 /gene="MIR151B" /replace="c" /replace="t" /db_xref="dbSNP:1886805794" variation 59 /gene="MIR151B" /replace="c" /replace="t" /db_xref="dbSNP:1382198461" ncRNA 60..77 /ncRNA_class="miRNA" /gene="MIR151B" /product="hsa-miR-151b" /db_xref="miRBase:MIMAT0010214" /db_xref="GeneID:100616247" /db_xref="HGNC:HGNC:41588" /db_xref="miRBase:MI0003772" variation 61 /gene="MIR151B" /replace="c" /replace="t" /db_xref="dbSNP:530616727" variation 62 /gene="MIR151B" /replace="a" /replace="g" /db_xref="dbSNP:1447689330" variation 67 /gene="MIR151B" /replace="a" /replace="g" /db_xref="dbSNP:1886804673" variation 75 /gene="MIR151B" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1167577108" variation 76 /gene="MIR151B" /replace="c" /replace="t" /db_xref="dbSNP:1886804079" variation 79 /gene="MIR151B" /replace="a" /replace="g" /db_xref="dbSNP:1886803843" variation 80..89 /gene="MIR151B" /replace="acaaac" /replace="acaaacaaac" /db_xref="dbSNP:1395702225" variation 81 /gene="MIR151B" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:962702855" variation 83 /gene="MIR151B" /replace="a" /replace="g" /db_xref="dbSNP:1886803290" variation 86 /gene="MIR151B" /replace="a" /replace="c" /db_xref="dbSNP:1018251166" variation 90 /gene="MIR151B" /replace="c" /replace="t" /db_xref="dbSNP:564864187" variation 91 /gene="MIR151B" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:189669291" ORIGIN
acctctgatgtgtcagtctctcttcagggctcccgagacacagaaacagacacctgccctcgaggagctcacagtctagacaaacaaacccagggt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]