2024-05-19 13:01:51, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_036211 86 bp RNA linear PRI 10-JUL-2022 DEFINITION Homo sapiens microRNA 4257 (MIR4257), microRNA. ACCESSION NR_036211 VERSION NR_036211.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 86) AUTHORS Kataoka S, Arita T, Konishi H, Yamamoto Y, Shibata R, Yamamoto T, Shibamoto J, Furuke H, Takabatake K, Takaki W, Kiuchi J, Shimizu H, Komatsu S, Shiozaki A, Kuriu Y and Otsuji E. TITLE The Role of Inflammation-associated microRNA-4257 as a Promoter of Malignancy in Colorectal Cancer JOURNAL Anticancer Res 42 (7), 3349-3360 (2022) PUBMED 35790263 REMARK GeneRIF: The Role of Inflammation-associated microRNA-4257 as a Promoter of Malignancy in Colorectal Cancer. REFERENCE 2 (bases 1 to 86) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 86) AUTHORS Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE and Hart RP. TITLE Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors JOURNAL PLoS One 4 (9), e7192 (2009) PUBMED 19784364 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 86) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AL356356.17. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-86 AL356356.17 79191-79276 FEATURES Location/Qualifiers source 1..86 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="1" /map="1q21.2" gene 1..86 /gene="MIR4257" /note="microRNA 4257" /db_xref="GeneID:100422997" /db_xref="HGNC:HGNC:38312" /db_xref="miRBase:MI0015856" precursor_RNA 1..86 /gene="MIR4257" /product="microRNA 4257" /db_xref="GeneID:100422997" /db_xref="HGNC:HGNC:38312" /db_xref="miRBase:MI0015856" exon 1..86 /gene="MIR4257" /inference="alignment:Splign:2.1.0" variation 1 /gene="MIR4257" /replace="a" /replace="g" /db_xref="dbSNP:186779877" variation 4..5 /gene="MIR4257" /replace="t" /replace="tt" /db_xref="dbSNP:2101550629" variation 4 /gene="MIR4257" /replace="c" /replace="t" /db_xref="dbSNP:2101550588" variation 10 /gene="MIR4257" /replace="a" /replace="g" /db_xref="dbSNP:1570917867" variation 15 /gene="MIR4257" /replace="a" /replace="c" /db_xref="dbSNP:1041627961" variation 16 /gene="MIR4257" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1671451068" variation 22 /gene="MIR4257" /replace="c" /replace="t" /db_xref="dbSNP:903136375" variation 23 /gene="MIR4257" /replace="a" /replace="t" /db_xref="dbSNP:1000118867" variation 28 /gene="MIR4257" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1299078981" variation 35 /gene="MIR4257" /replace="a" /replace="g" /db_xref="dbSNP:1006295434" variation 40 /gene="MIR4257" /replace="c" /replace="t" /db_xref="dbSNP:1183813781" variation 41..46 /gene="MIR4257" /replace="aag" /replace="aagaag" /db_xref="dbSNP:1671453229" variation 45..58 /gene="MIR4257" /replace="" /replace="agcccctacagggc" /db_xref="dbSNP:1350314446" variation 46 /gene="MIR4257" /replace="a" /replace="g" /db_xref="dbSNP:1015936176" variation 47 /gene="MIR4257" /replace="a" /replace="c" /db_xref="dbSNP:1671454192" variation 48 /gene="MIR4257" /replace="c" /replace="t" /db_xref="dbSNP:1560283241" variation 49 /gene="MIR4257" /replace="c" /replace="g" /db_xref="dbSNP:1292239766" variation 53 /gene="MIR4257" /replace="c" /replace="t" /db_xref="dbSNP:1393344561" variation 54 /gene="MIR4257" /replace="a" /replace="g" /db_xref="dbSNP:900376298" variation 55 /gene="MIR4257" /replace="a" /replace="g" /db_xref="dbSNP:1387778139" ncRNA 59..76 /ncRNA_class="miRNA" /gene="MIR4257" /product="hsa-miR-4257" /db_xref="miRBase:MIMAT0016878" /db_xref="GeneID:100422997" /db_xref="HGNC:HGNC:38312" /db_xref="miRBase:MI0015856" variation 60 /gene="MIR4257" /replace="c" /replace="t" /db_xref="dbSNP:1671455946" variation 62 /gene="MIR4257" /replace="g" /replace="t" /db_xref="dbSNP:2101551407" variation 64 /gene="MIR4257" /replace="a" /replace="g" /db_xref="dbSNP:74743733" variation 65 /gene="MIR4257" /replace="g" /replace="t" /db_xref="dbSNP:1338780840" variation 74 /gene="MIR4257" /replace="a" /replace="g" /db_xref="dbSNP:1221318744" variation 76 /gene="MIR4257" /replace="a" /replace="g" /db_xref="dbSNP:1322687799" variation 77 /gene="MIR4257" /replace="c" /replace="t" /db_xref="dbSNP:1671457579" variation 78 /gene="MIR4257" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:963860752" variation 82 /gene="MIR4257" /replace="a" /replace="g" /db_xref="dbSNP:1671458317" variation 85..86 /gene="MIR4257" /replace="g" /replace="gg" /db_xref="dbSNP:1671458626" ORIGIN
ggcttagaaacagtccctaggtaggatttggggaggagctaagaagcccctacagggcccagaggtggggactgagccttagttgg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]