2024-05-19 16:59:16, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_036209 72 bp RNA linear PRI 13-NOV-2022 DEFINITION Homo sapiens microRNA 4324 (MIR4324), microRNA. ACCESSION NR_036209 VERSION NR_036209.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 72) AUTHORS Gao P, Zhu H, Pei W, Xu P and Ding Y. TITLE [Expression of miR-4324 and its targeted gene Talin2 in breast cancer] JOURNAL Nan Fang Yi Ke Da Xue Xue Bao 42 (10), 1517-1525 (2022) PUBMED 36329586 REMARK GeneRIF: [Expression of miR-4324 and its targeted gene Talin2 in breast cancer]. REFERENCE 2 (bases 1 to 72) AUTHORS Wu H, Yan Y, Yuan J, Luo M and Wang Y. TITLE miR-4324 inhibits ovarian cancer progression by targeting FEN1 JOURNAL J Ovarian Res 15 (1), 32 (2022) PUBMED 35246224 REMARK GeneRIF: miR-4324 inhibits ovarian cancer progression by targeting FEN1. Publication Status: Online-Only REFERENCE 3 (bases 1 to 72) AUTHORS Kim KH, Abu Elneel K, Shin JW, Keum JW, Seong D, Kwak S, Lee R, Gusella JF, MacDonald ME, Seong IS and Lee JM. TITLE Full sequence of mutant huntingtin 3'-untranslated region and modulation of its gene regulatory activity by endogenous microRNA JOURNAL J Hum Genet 64 (10), 995-1004 (2019) PUBMED 31296921 REMARK GeneRIF: In miRNA activity assays using the full-length hap.01 and hap.08 3'-UTR reporter vectors and follow-up validation experiments, hsa-miR-4324 and hsa-miR-4756-5p significantly reduced huntingtin gene (HTT) 3'-UTR reporter activity and endogenous HTT protein levels. REFERENCE 4 (bases 1 to 72) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 72) AUTHORS Kozomara A and Griffiths-Jones S. TITLE miRBase: integrating microRNA annotation and deep-sequencing data JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011) PUBMED 21037258 REFERENCE 6 (bases 1 to 72) AUTHORS Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE and Hart RP. TITLE Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors JOURNAL PLoS One 4 (9), e7192 (2009) PUBMED 19784364 REMARK Publication Status: Online-Only REFERENCE 7 (bases 1 to 72) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC011450.4. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. ##Evidence-Data-START## Transcript is intronless :: LM611152.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-72 AC011450.4 40847-40918 FEATURES Location/Qualifiers source 1..72 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="19" /map="19q13.33" gene 1..72 /gene="MIR4324" /gene_synonym="mir-4324" /note="microRNA 4324" /db_xref="GeneID:100422979" /db_xref="HGNC:HGNC:38392" /db_xref="miRBase:MI0015854" precursor_RNA 1..72 /gene="MIR4324" /gene_synonym="mir-4324" /product="microRNA 4324" /db_xref="GeneID:100422979" /db_xref="HGNC:HGNC:38392" /db_xref="miRBase:MI0015854" exon 1..72 /gene="MIR4324" /gene_synonym="mir-4324" /inference="alignment:Splign:2.1.0" variation 1 /gene="MIR4324" /gene_synonym="mir-4324" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:772628575" variation 2 /gene="MIR4324" /gene_synonym="mir-4324" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:779989558" variation 3 /gene="MIR4324" /gene_synonym="mir-4324" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:186859566" variation 5 /gene="MIR4324" /gene_synonym="mir-4324" /replace="a" /replace="c" /db_xref="dbSNP:750479856" variation 6 /gene="MIR4324" /gene_synonym="mir-4324" /replace="c" /replace="t" /db_xref="dbSNP:941935826" variation 9 /gene="MIR4324" /gene_synonym="mir-4324" /replace="g" /replace="t" /db_xref="dbSNP:1970447321" variation 11 /gene="MIR4324" /gene_synonym="mir-4324" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1449764052" variation 13 /gene="MIR4324" /gene_synonym="mir-4324" /replace="g" /replace="t" /db_xref="dbSNP:765453084" variation 15 /gene="MIR4324" /gene_synonym="mir-4324" /replace="a" /replace="c" /db_xref="dbSNP:550970166" variation 17 /gene="MIR4324" /gene_synonym="mir-4324" /replace="g" /replace="t" /db_xref="dbSNP:1327533513" variation 21 /gene="MIR4324" /gene_synonym="mir-4324" /replace="c" /replace="t" /db_xref="dbSNP:2146124049" variation 22 /gene="MIR4324" /gene_synonym="mir-4324" /replace="a" /replace="c" /db_xref="dbSNP:752461895" variation 25 /gene="MIR4324" /gene_synonym="mir-4324" /replace="c" /replace="t" /db_xref="dbSNP:1372285194" variation 26 /gene="MIR4324" /gene_synonym="mir-4324" /replace="c" /replace="t" /db_xref="dbSNP:2146124021" variation 27 /gene="MIR4324" /gene_synonym="mir-4324" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1301238089" variation 28 /gene="MIR4324" /gene_synonym="mir-4324" /replace="c" /replace="t" /db_xref="dbSNP:1970446797" variation 29 /gene="MIR4324" /gene_synonym="mir-4324" /replace="a" /replace="g" /db_xref="dbSNP:1423986558" variation 30 /gene="MIR4324" /gene_synonym="mir-4324" /replace="c" /replace="g" /db_xref="dbSNP:1374056878" variation 32 /gene="MIR4324" /gene_synonym="mir-4324" /replace="a" /replace="g" /db_xref="dbSNP:1432407248" variation 34 /gene="MIR4324" /gene_synonym="mir-4324" /replace="a" /replace="c" /db_xref="dbSNP:1970446524" variation 37 /gene="MIR4324" /gene_synonym="mir-4324" /replace="c" /replace="t" /db_xref="dbSNP:746362642" variation 38 /gene="MIR4324" /gene_synonym="mir-4324" /replace="c" /replace="t" /db_xref="dbSNP:767353494" ncRNA 43..62 /ncRNA_class="miRNA" /gene="MIR4324" /gene_synonym="mir-4324" /product="hsa-miR-4324" /db_xref="miRBase:MIMAT0016876" /db_xref="GeneID:100422979" /db_xref="HGNC:HGNC:38392" /db_xref="miRBase:MI0015854" variation 43 /gene="MIR4324" /gene_synonym="mir-4324" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1164845406" variation 44 /gene="MIR4324" /gene_synonym="mir-4324" /replace="c" /replace="t" /db_xref="dbSNP:759457721" variation 48 /gene="MIR4324" /gene_synonym="mir-4324" /replace="a" /replace="c" /db_xref="dbSNP:879237333" variation 51 /gene="MIR4324" /gene_synonym="mir-4324" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:766233355" variation 52..69 /gene="MIR4324" /gene_synonym="mir-4324" /replace="" /replace="cctaaccttaaaggtgct" /db_xref="dbSNP:1970445636" variation 52 /gene="MIR4324" /gene_synonym="mir-4324" /replace="c" /replace="t" /db_xref="dbSNP:762468953" variation 57 /gene="MIR4324" /gene_synonym="mir-4324" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:772627748" variation 62 /gene="MIR4324" /gene_synonym="mir-4324" /replace="a" /replace="g" /db_xref="dbSNP:779503344" variation 64 /gene="MIR4324" /gene_synonym="mir-4324" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1600634478" variation 66 /gene="MIR4324" /gene_synonym="mir-4324" /replace="g" /replace="t" /db_xref="dbSNP:1970445786" variation 67 /gene="MIR4324" /gene_synonym="mir-4324" /replace="g" /replace="t" /db_xref="dbSNP:1254355750" variation 69 /gene="MIR4324" /gene_synonym="mir-4324" /replace="c" /replace="t" /db_xref="dbSNP:1220863204" variation 70 /gene="MIR4324" /gene_synonym="mir-4324" /replace="a" /replace="g" /db_xref="dbSNP:747851962" variation 71 /gene="MIR4324" /gene_synonym="mir-4324" /replace="c" /replace="t" /db_xref="dbSNP:777122216" ORIGIN
cggcccctttgttaagggtctcagctccagggaactttaaaaccctgagaccctaaccttaaaggtgctgca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]