2024-05-19 16:49:41, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001425285 5336 bp mRNA linear PRI 08-NOV-2023 DEFINITION Homo sapiens retrotransposon Gag like 1 (RTL1), transcript variant 2, mRNA. ACCESSION NM_001425285 XM_047431358 XM_054376024 VERSION NM_001425285.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 5336) AUTHORS Mahmoudi AR, Ghods R, Madjd Z, Abolhasani M, Saeednejad Zanjani L, Safaei M, Balaei Goli L, Vafaei S, Katouzian L, Soltanghoraei H, Shekarabi M and Zarnani AH. TITLE Expression profiling of RTL1 in human breast cancer tissues and cell lines JOURNAL Exp Mol Pathol 121, 104654 (2021) PUBMED 34087231 REMARK GeneRIF: Expression profiling of RTL1 in human breast cancer tissues and cell lines. REFERENCE 2 (bases 1 to 5336) AUTHORS Kitazawa M, Sutani A, Kaneko-Ishino T and Ishino F. TITLE The role of eutherian-specific RTL1 in the nervous system and its implications for the Kagami-Ogata and Temple syndromes JOURNAL Genes Cells 26 (3), 165-179 (2021) PUBMED 33484574 REMARK GeneRIF: The role of eutherian-specific RTL1 in the nervous system and its implications for the Kagami-Ogata and Temple syndromes. REFERENCE 3 (bases 1 to 5336) AUTHORS Prats-Puig A, Carreras-Badosa G, Bassols J, Cavelier P, Magret A, Sabench C, de Zegher F, Ibanez L, Feil R and Lopez-Bermejo A. TITLE The placental imprinted DLK1-DIO3 domain: a new link to prenatal and postnatal growth in humans JOURNAL Am J Obstet Gynecol 217 (3), 350 (2017) PUBMED 28502757 REMARK GeneRIF: We find that placental expression of DIO3 and RTL1) correlates with prenatal growth. Combined, these findings suggest that epigenetic programming and gene expression within the DLK1-DIO3 imprinted domain influence both prenatal and postnatal growth. REFERENCE 4 (bases 1 to 5336) AUTHORS Belot MP, Naderi K, Mille C, Boelle PY, Benachi A, Bougneres P and Fradin D. TITLE Role of DNA methylation at the placental RTL1 gene locus in type 1 diabetes JOURNAL Pediatr Diabetes 18 (3), 178-187 (2017) PUBMED 27174469 REMARK GeneRIF: Data suggest that DNA is differentially methylated (hypomethylated) at a gene locus associated with regulation of expression of RTL1 and miR136 in type 1 diabetes; these studies were conducted using tissue bank placentas and whole blood cell DNA from children with type 1 diabetes. (RTL1 = retrotransposon-like protein 1; miR136 = microRNA 136) REFERENCE 5 (bases 1 to 5336) AUTHORS Bundo M, Toyoshima M, Okada Y, Akamatsu W, Ueda J, Nemoto-Miyauchi T, Sunaga F, Toritsuka M, Ikawa D, Kakita A, Kato M, Kasai K, Kishimoto T, Nawa H, Okano H, Yoshikawa T, Kato T and Iwamoto K. TITLE Increased l1 retrotransposition in the neuronal genome in schizophrenia JOURNAL Neuron 81 (2), 306-313 (2014) PUBMED 24389010 REMARK GeneRIF: The results of this study suggest that hyperactive retrotransposition of L1 in neurons triggered by environmental and/or genetic risk factors may contribute to the susceptibility and pathophysiology of schizophrenia. REFERENCE 6 (bases 1 to 5336) AUTHORS Kagami M, Sekita Y, Nishimura G, Irie M, Kato F, Okada M, Yamamori S, Kishimoto H, Nakayama M, Tanaka Y, Matsuoka K, Takahashi T, Noguchi M, Tanaka Y, Masumoto K, Utsunomiya T, Kouzan H, Komatsu Y, Ohashi H, Kurosawa K, Kosaki K, Ferguson-Smith AC, Ishino F and Ogata T. TITLE Deletions and epimutations affecting the human 14q32.2 imprinted region in individuals with paternal and maternal upd(14)-like phenotypes JOURNAL Nat Genet 40 (2), 237-242 (2008) PUBMED 18176563 REMARK GeneRIF: RTL1, a paternally expressed gene in a cluster of imprinted genes on chromosome 14q32.2, is associated with upd(14)pat-like and upd(14)mat-like phenotypes. REFERENCE 7 (bases 1 to 5336) AUTHORS Youngson NA, Kocialkowski S, Peel N and Ferguson-Smith AC. TITLE A small family of sushi-class retrotransposon-derived genes in mammals and their relation to genomic imprinting JOURNAL J Mol Evol 61 (4), 481-490 (2005) PUBMED 16155747 REFERENCE 8 (bases 1 to 5336) AUTHORS Davis E, Caiment F, Tordoir X, Cavaille J, Ferguson-Smith A, Cockett N, Georges M and Charlier C. TITLE RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus JOURNAL Curr Biol 15 (8), 743-749 (2005) PUBMED 15854907 REMARK Erratum:[Curr Biol. 2005 May 10;15(9):884] REFERENCE 9 (bases 1 to 5336) AUTHORS Brandt J, Veith AM and Volff JN. TITLE A family of neofunctionalized Ty3/gypsy retrotransposon genes in mammalian genomes JOURNAL Cytogenet Genome Res 110 (1-4), 307-317 (2005) PUBMED 16093683 REFERENCE 10 (bases 1 to 5336) AUTHORS Seitz H, Youngson N, Lin SP, Dalbert S, Paulsen M, Bachellerie JP, Ferguson-Smith AC and Cavaille J. TITLE Imprinted microRNA genes transcribed antisense to a reciprocally imprinted retrotransposon-like gene JOURNAL Nat Genet 34 (3), 261-262 (2003) PUBMED 12796779 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL117190.6. On or before Nov 8, 2023 this sequence version replaced XM_047431358.1, XM_054376024.1. Summary: This gene is a retrotransposon-derived, paternally expressed imprinted gene that is highly expressed at the late fetal stage in both the fetus and placenta. It has an overlapping maternally expressed antisense transcript, which contains several microRNAs targeting the transcripts of this gene through an RNA interference (RNAi) mechanism. This gene is essential for maintenance of the fetal capillaries. [provided by RefSeq, Jul 2009]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: ERR4352442.307362.1, ERR4352444.199182.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2142853, SAMEA2149398 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## imprinted gene :: PMID: 18176563 ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-118 AL117190.6 143721-143838 c 119-214 AL117190.6 143407-143502 c 215-5336 AL117190.6 119869-124990 c FEATURES Location/Qualifiers source 1..5336 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="14" /map="14q32.2-q32.31" gene 1..5336 /gene="RTL1" /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2" /note="retrotransposon Gag like 1" /db_xref="GeneID:388015" /db_xref="HGNC:HGNC:14665" /db_xref="MIM:611896" exon 1..118 /gene="RTL1" /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2" /inference="alignment:Splign:2.1.0" exon 119..214 /gene="RTL1" /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2" /inference="alignment:Splign:2.1.0" exon 215..5336 /gene="RTL1" /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2" /inference="alignment:Splign:2.1.0" misc_feature 241..243 /gene="RTL1" /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2" /note="upstream in-frame stop codon" CDS 301..4377 /gene="RTL1" /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2" /note="mammalian retrotransposon derived protein 1; paternally expressed gene 11 protein; retrotransposon-derived protein PEG11; Sushi-Ichi retrotransposon homolog 2; mammalian retrotransposon-derived 1; paternally expressed 11; retrotransposon-like 1" /codon_start=1 /product="retrotransposon-like protein 1" /protein_id="NP_001412214.1" /db_xref="GeneID:388015" /db_xref="HGNC:HGNC:14665" /db_xref="MIM:611896" /translation="
MIEPSEDSFETMMEHKNPSSKQMESSEGSSNTTEATSGSGVRGEAGPASGPAQEKKEPPSGPLQEMEELPTDLLQDMEEPSSGPRKEIEDPPNDLLQDLEESCNGSHQARGDPLSGASDRMKEASVNPSGAREEQEAHTDLKESGREETPQEQNQTEHSTAELMAMVRSIISLYFRMQDLKEQQRVAEEILIKGINAGQLPAPKHFSGDRREFHEFIVLCQLTLQSYPRMFYNDRLRVGYVINHLSGLALEWAKALLQENSPLIGDFPAFLEAMSEVFEYRQALRVAEEAMFTIRQGGRSATEYIDEFQSLVPILGWPDEVLQAHLCQGLNEEIRHYLFRVPQPDSLDSLIVLILQIEEKLAERRAMLRLPPEARPRNLTWIDSPAPERWMVSSWLPSEVHPDINRAHLFLLLMVRVNPYHSVAVQALVDSGADGNFMDEKFAQEHYVELYEKPYPQPVQSVDGSLIGNEPVWLYTEPLVCIHQNHQESIEFDIVPSPNFSVVLGIRWLRVHAPEVDWIKGRCTFHSPYCLKNCFRPPPPCIALERHGMSLLPGLPHPYSDLADVFNPKEADDETSDQPSSDGSDDLSESEPSELQQAGDSDHSETFYECPSTAPWEPVGARMQERARLQEEYWDLQDMLTNRQDYIQMIPELFDQLHGAEWFTKLELRGTIVEESVNGHRTEDVWKAAFGLELEEMKSYQPFALSPDPIIPQNVIHFILKDMLGFFVLSYGQEVLIYSMSQEEHLHHVRQVLVRFRHHNVYCSLDKSQFHRQTVEFLGFVVTPKGVKLNKNVMTIITGYPTPGSKLSLRNFIEFVFPYRHFVERFSIIAEPLVRQLLSSYQFYWGVEEQEAFECLKRAFRKAPLLHHPKPQNPFYLETGVTGTALHASLIQIDDQTGKRACCAFYSRNISPIEVEYSQAEMKILPIRAAFMVWCRYLENTEEPIMILLNTEDLASLNNDRLTVLLPGHWVFFFSHFNFDVMELPEQDGGRALPPVRNLRWRRAFQRNTAARQTLLLASRGFPRDPSTESGEEENEEQDELNEQILRQELLAMIPIDQILNSFLAHFSMAQIRAVILHFFRGLLYWKNTLALAAILVLLRVRQCLSLRPAPAMRVARPQPQRSLRLILDSSLIAGSSITTAITQLLTQMPALVGANTIPAQELAELFLGPGRWQRNALHSQAHRGLQFTPGFWLTLCEFFGVRVTPQEGHLPALRQNRYLELHVVGDEDVVLREALQDDLQRYRQCGLHDGLQDTSQDKQDNDVQEAPPSHTAATHPPRPRHLMDPQVLEFLGSRLLHIHSADGQLHLLSREQAARALSQFLTLIYRRALPIPAWESQPREQARLEELPDEDEDANLD"
misc_feature 301..777 /gene="RTL1" /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2" /note="propagated from UniProtKB/Swiss-Prot (A6NKG5.3); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 1987..2148 /gene="RTL1" /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2" /note="propagated from UniProtKB/Swiss-Prot (A6NKG5.3); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 3547..3597 /gene="RTL1" /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2" /note="propagated from UniProtKB/Swiss-Prot (A6NKG5.3); transmembrane region" misc_feature 3676..3738 /gene="RTL1" /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2" /note="propagated from UniProtKB/Swiss-Prot (A6NKG5.3); transmembrane region" misc_feature 4048..4149 /gene="RTL1" /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2" /note="propagated from UniProtKB/Swiss-Prot (A6NKG5.3); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 4312..4374 /gene="RTL1" /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2" /note="propagated from UniProtKB/Swiss-Prot (A6NKG5.3); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" regulatory 5317..5322 /regulatory_class="polyA_signal_sequence" /gene="RTL1" /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2" /note="hexamer: AATAAA" polyA_site 5336 /gene="RTL1" /gene_synonym="HUR1; Mar1; MART1; PEG11; SIRH2" /note="major polyA site" ORIGIN
acacccccccagcactcggcacagcctcgctgagcagccttcagcagcagggtgtggtggggagcctcggagagtctggggttccatcctggcccagcctcacaccagctgagagacgaccgactgagcttcgaggacaggaagccaccggcatcactaagccaccggcatcacttcatccccagcctcacgcttgggactgggcccggggaaggttctgatctccacggtcccagctactgactggacgccatcacaaccttaccaatcttcagaatacactcctttccatccgacgaaatgatagaaccctctgaagactcatttgagacgatgatggagcataagaatccatcatcaaaacaaatggagtcctccgagggctcatccaacaccaccgaggcgacgtcgggcagtggagtgcggggagaggcagggccagccagcggcccagcccaggaaaagaaggagccccccagtggcccactccaggaaatggaagagctgcccactgatctactccaagacatggaggagccatccagtggcccacgtaaggaaatagaggatccacccaatgacctactccaagacctggaggagtcatgcaacggttcacaccaggcaaggggggatccactcagtggagcatctgataggatgaaagaagcatcagtcaacccatcgggagcccgagaagaacaagaggctcacactgacctgaaggaatcgggaagggaggagactcctcaagagcaaaaccagaccgagcactcaaccgcagaacttatggccatggtgaggtccatcatctcgctgtacttccgaatgcaagacctcaaagagcaacagagagtagcagaagagatcttgatcaaagggatcaatgcaggccaactgcccgccccaaagcacttctctggcgatcgcagagaattccacgagttcatcgtactctgccaactgaccttacagagctacccaagaatgttctataacgaccgtctgagagttggctatgtcatcaatcacctgtccggcttggcattagaatgggccaaagctctactgcaggaaaacagccccctgatcggagacttcccagccttcctggaggccatgtccgaagtgtttgagtaccgccaggcactgcgtgtggcagaagaggccatgttcaccatcaggcagggcggccgctctgccactgagtacatcgatgagttccagagcctggtacccatcttgggctggccagatgaagtcctgcaggcccacttgtgccaggggctcaacgaggagatcaggcactatctattccgggtccctcagccggattccctagacagtctgattgtgctcatcctgcaaatagaagagaagctggcagagagaagagctatgctcaggctgccccccgaggcccgcccccggaacctgacctggatcgactcacctgctccagagaggtggatggtcagcagctggttgcccagcgaagtccatccggacatcaatcgcgcccacctcttcctgctgctcatggtgagagtgaacccctaccacagcgtcgcggtccaggccctggtggattcgggagctgacggcaacttcatggatgagaagttcgcccaagagcactacgtcgagctctacgagaagccgtacccacagccggtccaatccgtggacggctcgctgattggcaacgagcctgtctggctctacacggagcccctggtgtgtatccaccagaaccaccaggagtccatcgaatttgacatcgtaccttcaccgaacttctctgtggtcctaggcatccgctggctccgagtccacgcccccgaagtcgactggatcaaaggccgctgcaccttccactctccctactgcctgaagaactgcttccgcccgcccccgccatgcattgccctagagaggcacggcatgagcctgctacccggactgccacacccatactcagacctggccgacgtgtttaacccgaaggaagcagatgatgagacttccgaccagccaagctcagacggatccgatgatctttctgaatcagagccctctgagcttcagcaggctggagacagtgatcacagcgagaccttttacgagtgtccctccaccgcgccttgggaacctgtgggtgccaggatgcaagaaagagccaggctacaggaggaatactgggacctgcaggacatgctgaccaacagacaggactacatacagatgattccggaactgtttgaccagttacacggagccgagtggttcacaaaactggagctgcgtgggaccattgtggaggaaagcgtgaacgggcaccgcaccgaagatgtgtggaaagcagcgtttggtttggagcttgaagagatgaagagctaccagccgtttgcgctctccccagaccctatcatacctcagaacgtgattcacttcatcctaaaggacatgctagggttctttgtgctttcttatggccaggaagtcctgatctactcaatgagtcaggaggagcacctccaccacgtccgccaagtcctggtccgcttccgccatcacaacgtctactgctccctggacaagagccagttccaccgccaaaccgtggaattcctgggcttcgtcgtcacccccaaaggggtgaaactgaacaagaacgtcatgaccatcataacagggtaccctacccctggctccaagctatctctgcgaaacttcatcgaattcgtcttcccctaccgccacttcgtggagcgcttcagcatcatcgcagagcccctggtgcggcagctgctgagctcctaccagttctactggggagtcgaggagcaagaggccttcgagtgcctgaagagggctttccgcaaggcgcctctcctccaccaccccaagccccagaacccattctacttggaaaccggcgtcaccggcacggccctgcacgcctccctgatccaaatcgacgaccaaaccggcaagagagcctgctgcgctttctactcccgcaacatctcccctatcgaggttgagtactctcaagcggagatgaagattcttccaatacgggctgccttcatggtgtggtgccgctacctggagaacaccgaggagcccatcatgatccttctcaacacagaggatctagcctctctgaataatgacaggctcaccgtacttctccccgggcattgggtcttcttcttctcccacttcaactttgacgtcatggagctgccagaacaagacggcggccgagctctgccacctgtgagaaacctccggtggaggagagccttccagaggaacactgccgccaggcaaaccctgctgctggcctcaaggggattccccagggatccatcgacggaatccggggaagaagagaatgaagaacaggatgagctcaatgaacagatcctacggcaagagctgctggccatgatacccatcgaccagatcctcaacagcttcctcgcccacttcagcatggcccagatcagggccgtcattctgcacttcttccgaggcctcctgtactggaagaacaccctagccctggcagccatcctcgtgctactgcgcgtgaggcaatgcctctcgctgcggccggcacccgccatgcgggtggctcggccccagccccagcgctccctacgactcatcctggattcgtccctcatcgcaggcagcagcatcacgacagccatcacccagctgctcacccagatgcccgctctcgtaggtgcaaacaccatcccagcccaggagctggctgagctgttcctgggccctggccgctggcagcgaaatgctctgcactcccaggcccaccgaggcctgcagttcacccctggcttctggctgacgctgtgtgagttcttcggtgtcagagtcaccccccaggagggccacctccctgccctgcgtcagaaccgctacctggagctgcacgtcgttggtgatgaggatgtcgtcttgcgagaagccctgcaagacgacctgcaacgttaccgtcagtgtggcctgcatgacggcctgcaagacacctcgcaggacaagcaggacaacgacgtgcaggaggccccacccagccacacagcagccacccacccaccccgcccacgccacctgatggatccccaggtcctggaattccttggtagccgcctgctccacatccacagtgcagatggccagctgcacctgctcagccgggagcaggcagccagggccctgagccagttcctgaccctgatctacaggcgggccctgcccatccccgcctgggagagccagcccagggagcaggcaaggctagaagagctgcctgatgaggacgaagatgctaacctcgactgaagacgcctccctgtctccagcaaagagtcccctctatttctcaccccaacacctcccgacgtcccctggcctccccgcgcctcagcctgcttcgcttcccttcctgccactcctgacccaagaggaacccacttgtgaagggcaacaacttcttcaactcatcaaccagcaatgccacctgtgctaacggactacccagtcctcagagacccagcgccagccctgggctacgagttctccgttctccaggtcccaagcccatgcccgggagtgacatccatgagggagaaagcagtggtgagcaggaagtgaccccatgacgcgtggccagatgaagaagcaggcacagcaggcgcagccaagcaagcaggtgacggggccccccacccggcctggtgatggccaccctgggacactgacctcgggtgctccactgacttcttctacctccactgccggtgctcctgctcccctgagctcccgcccccgccccccaacccccatcccccaacctcccgacatctgatgatgtggtgcctccctcacccccatcacaccctgcaagcaaacccacccccacccccaccacatctgcttcagcttttttgaccccgccttcctcttgccctgagctctggacttacctggacaaagccgctctttggggcatccggacgtaccagtgccacttaccagacttgcacagcaaagagggcccctgcatgccttggggcgcctttccctcccaacactgaacactggacagtgcaggggtgcaggggcccctcatacagggatggagtcccagaaggcacacagacacccaggggaccatgccgagtcacagagaggctctggccacaccaccgctttgcaaggggagtagacccttccccaccccccgagctttctcaccccccaatctttttgcactcctcaaataaagcaaactaaaagac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]