GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-19 16:49:37, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_001349369            1125 bp    mRNA    linear   PRI 02-AUG-2023
DEFINITION  Homo sapiens centromere protein K (CENPK), transcript variant 5,
            mRNA.
ACCESSION   NM_001349369 XM_017009699
VERSION     NM_001349369.2
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1125)
  AUTHORS   Li X, Han YR, Xuefeng X, Ma YX, Xing GS, Yang ZW, Zhang Z, Shi L
            and Wu XL.
  TITLE     Lentivirus-mediated short hairpin RNA interference of CENPK
            inhibits growth of colorectal cancer cells with overexpression of
            Cullin 4A
  JOURNAL   World J Gastroenterol 28 (37), 5420-5443 (2022)
   PUBMED   36312839
  REMARK    GeneRIF: Lentivirus-mediated short hairpin RNA interference of
            CENPK inhibits growth of colorectal cancer cells with
            overexpression of Cullin 4A.
REFERENCE   2  (bases 1 to 1125)
  AUTHORS   Tian T, Chen L, Dou Z, Yang Z, Gao X, Yuan X, Wang C, Liu R, Shen
            Z, Gui P, Teng M, Meng X, Hill DL, Li L, Zhang X, Liu X, Sun L,
            Zang J and Yao X.
  TITLE     Structural insights into human CCAN complex assembled onto DNA
  JOURNAL   Cell Discov 8 (1), 90 (2022)
   PUBMED   36085283
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1125)
  AUTHORS   Tian H, Wang F, Deng Y, Ying L, Fang W, Chen D, Miao C, Li H, Sun
            S, Ma Y, Cai H and Guo T.
  TITLE     Centromeric protein K (CENPK) promotes gastric cancer proliferation
            and migration via interacting with XRCC5
  JOURNAL   Gastric Cancer 25 (5), 879-895 (2022)
   PUBMED   35715658
  REMARK    GeneRIF: Centromeric protein K (CENPK) promotes gastric cancer
            proliferation and migration via interacting with XRCC5.
REFERENCE   4  (bases 1 to 1125)
  AUTHORS   Lin X, Wang F, Chen J, Liu J, Lin YB, Li L, Chen CB and Xu Q.
  TITLE     N6-methyladenosine modification of CENPK mRNA by ZC3H13 promotes
            cervical cancer stemness and chemoresistance
  JOURNAL   Mil Med Res 9 (1), 19 (2022)
   PUBMED   35418160
  REMARK    GeneRIF: N(6)-methyladenosine modification of CENPK mRNA by ZC3H13
            promotes cervical cancer stemness and chemoresistance.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1125)
  AUTHORS   Li Q, Liang J, Zhang S, An N, Xu L and Ye C.
  TITLE     Overexpression of centromere protein K (CENPK) gene in
            Differentiated Thyroid Carcinoma promote cell Proliferation and
            Migration
  JOURNAL   Bioengineered 12 (1), 1299-1310 (2021)
   PUBMED   33904381
  REMARK    GeneRIF: Overexpression of centromere protein K (CENPK) gene in
            Differentiated Thyroid Carcinoma promote cell Proliferation and
            Migration.
REFERENCE   6  (bases 1 to 1125)
  AUTHORS   Okada M, Cheeseman IM, Hori T, Okawa K, McLeod IX, Yates JR 3rd,
            Desai A and Fukagawa T.
  TITLE     The CENP-H-I complex is required for the efficient incorporation of
            newly synthesized CENP-A into centromeres
  JOURNAL   Nat Cell Biol 8 (5), 446-457 (2006)
   PUBMED   16622420
REFERENCE   7  (bases 1 to 1125)
  AUTHORS   Foltz DR, Jansen LE, Black BE, Bailey AO, Yates JR 3rd and
            Cleveland DW.
  TITLE     The human CENP-A centromeric nucleosome-associated complex
  JOURNAL   Nat Cell Biol 8 (5), 458-469 (2006)
   PUBMED   16622419
REFERENCE   8  (bases 1 to 1125)
  AUTHORS   Obuse C, Yang H, Nozaki N, Goto S, Okazaki T and Yoda K.
  TITLE     Proteomics analysis of the centromere complex from HeLa interphase
            cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of
            the CEN-complex, while BMI-1 is transiently co-localized with the
            centromeric region in interphase
  JOURNAL   Genes Cells 9 (2), 105-120 (2004)
   PUBMED   15009096
REFERENCE   9  (bases 1 to 1125)
  AUTHORS   Yamashita A, Ito M, Takamatsu N and Shiba T.
  TITLE     Characterization of Solt, a novel SoxLZ/Sox6 binding protein
            expressed in adult mouse testis
  JOURNAL   FEBS Lett 481 (2), 147-151 (2000)
   PUBMED   10996314
REFERENCE   10 (bases 1 to 1125)
  AUTHORS   Taki T, Hayashi Y, Taniwaki M, Seto M, Ueda R, Hanada R, Suzukawa
            K, Yokota J and Morishita K.
  TITLE     Fusion of the MLL gene with two different genes, AF-6 and
            AF-5alpha, by a complex translocation involving chromosomes 5, 6, 8
            and 11 in infant leukemia
  JOURNAL   Oncogene 13 (10), 2121-2130 (1996)
   PUBMED   8950979
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BG502832.1, BG505115.1, BC005400.1 and AC016620.7.
            
            On May 31, 2019 this sequence version replaced NM_001349369.1.
            
            Summary: CENPK is a subunit of a CENPH (MIM 605607)-CENPI (MIM
            300065)-associated centromeric complex that targets CENPA (MIM
            117139) to centromeres and is required for proper kinetochore
            function and mitotic progression (Okada et al., 2006 [PubMed
            16622420]).[supplied by OMIM, Mar 2008].
            
            Transcript Variant: This variant (5) differs in the 5' UTR, lacks a
            portion of the 5' coding region, initiates translation at a
            downstream start codon, and contains an alternate terminal exon,
            resulting in a novel 3' coding region, compared to variant 1. The
            encoded isoform (5) has a shorter N-terminus and a distinct
            C-terminus compared to isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1163655.583260.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA1965299,
                                           SAMEA1966682 [ECO:0006172]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-41                BG502832.1         2-42
            42-444              BG505115.1         10-412
            445-815             BC005400.1         449-819
            816-1125            AC016620.7         70827-71136
FEATURES             Location/Qualifiers
     source          1..1125
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5q12.3"
     gene            1..1125
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="centromere protein K"
                     /db_xref="GeneID:64105"
                     /db_xref="HGNC:HGNC:29479"
                     /db_xref="MIM:611502"
     exon            1..71
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1359976795"
     variation       2
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313487734"
     variation       3
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1752349587"
     variation       6
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1752348893"
     variation       7
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1752348579"
     variation       8
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306504051"
     variation       9
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1342831242"
     variation       11..20
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ggggctggca"
                     /replace="ggggctggcaggggctggca"
                     /db_xref="dbSNP:1485277906"
     variation       11
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1752347563"
     variation       12
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231982437"
     variation       13
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1028359789"
     variation       14
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:542352928"
     variation       15
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210224911"
     variation       19
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265798087"
     variation       21
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1752345149"
     variation       22..25
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="gc"
                     /replace="gcgc"
                     /db_xref="dbSNP:1257636747"
     variation       24
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1226707165"
     variation       28
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1752344063"
     variation       29
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1752343711"
     variation       30
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748792667"
     variation       31
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1422047918"
     variation       32
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1412446096"
     variation       33
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473419782"
     variation       34
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2150581284"
     variation       35
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1752342051"
     variation       36
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1343690787"
     variation       37
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140804671"
     variation       39
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553552680"
     variation       40
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1752340528"
     variation       41
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9791024"
     variation       42
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404435189"
     variation       45
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1413477558"
     variation       46
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1011178654"
     variation       48
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:892736211"
     variation       49
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293152372"
     variation       50
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1752337962"
     variation       52
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1004353263"
     variation       53
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364825946"
     variation       55
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1752336831"
     variation       56
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41268429"
     variation       61
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027093258"
     variation       62
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1003673595"
     variation       63
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995243929"
     variation       64
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558001621"
     variation       69
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1368732818"
     variation       71
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1157875168"
     exon            72..173
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       72
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548499564"
     variation       75..77
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tag"
                     /replace="tagttag"
                     /db_xref="dbSNP:1038778849"
     variation       77
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757254302"
     variation       84
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1751964644"
     variation       85
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225478568"
     variation       86
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1375448951"
     variation       90
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1751963569"
     variation       93
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1001509723"
     variation       94
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1445804221"
     variation       99
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171663462"
     variation       101
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1581126138"
     variation       103
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1374448596"
     variation       104
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906122153"
     variation       107
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:902390139"
     variation       114
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470058908"
     variation       115
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1751960081"
     variation       119
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1581126047"
     misc_feature    126..128
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="upstream in-frame stop codon"
     variation       127
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2150571791"
     variation       129
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358207757"
     variation       130
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173365559"
     variation       131
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1751958616"
     variation       133
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330586449"
     variation       134
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1337771016"
     variation       135
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401876701"
     variation       137
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1440214129"
     variation       140
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1581125889"
     variation       145
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1751955831"
     variation       146
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1751955343"
     variation       148
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409398045"
     variation       155
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189373120"
     variation       165
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158620897"
     variation       168
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1751953447"
     variation       170
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1024707099"
     variation       171
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950264084"
     variation       172
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1013728629"
     variation       173
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1053275890"
     exon            174..275
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       175
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757460492"
     variation       177
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777895549"
     variation       181
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2096371242"
     variation       183
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:935938524"
     variation       186
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2150532568"
     variation       187
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758896315"
     variation       188
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75497175"
     variation       190
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1216026136"
     variation       193
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371070860"
     variation       200
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1750726023"
     variation       201
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760004670"
     variation       202
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750725249"
     variation       210
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1397513933"
     variation       211
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750724525"
     variation       212
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754218341"
     variation       213
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766178671"
     variation       217
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760347848"
     variation       219
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1348543974"
     variation       222..226
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="actga"
                     /db_xref="dbSNP:1429400174"
     variation       224
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772652364"
     variation       225..233
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="gaagaa"
                     /replace="gaagaagaa"
                     /db_xref="dbSNP:1347528124"
     variation       230
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423115596"
     variation       231
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1750721303"
     variation       234
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150574725"
     variation       236
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201745679"
     variation       238
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481438294"
     variation       239
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774283954"
     variation       240
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141729484"
     variation       243
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206680426"
     variation       247
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1581093357"
     variation       253..255
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1437145639"
     variation       253
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1248409774"
     variation       254
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750716760"
     CDS             255..836
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="isoform 5 is encoded by transcript variant 5;
                     leucine zipper protein FKSG14; SoxLZ/Sox6-binding protein
                     Solt; protein AF-5alpha; interphase centromere complex
                     protein 37"
                     /codon_start=1
                     /product="centromere protein K isoform 5"
                     /protein_id="NP_001336298.1"
                     /db_xref="GeneID:64105"
                     /db_xref="HGNC:HGNC:29479"
                     /db_xref="MIM:611502"
                     /translation="
MWKDMEECQNKLSLIGTETLTDSNAQLSLLIMQVKCLTAELSQWQKKTPETIPLTEDVLITLGKEEFQKLRQDLEMVLSTKESKNEKLKEDLEREQRWLDEQQQIMESLNVLHSELKNKVETFSESRIFNELKTKMLNIKEYKEKLLSTLGEFLEDHFPLPDRSVKKKKKNIQESSVNLITLHEMLEVLSALG"
     misc_feature    255..821
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="Centromere-associated protein K; Region: CENP-K;
                     pfam11802"
                     /db_xref="CDD:432085"
     variation       256
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749111718"
     variation       260
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1750714903"
     variation       261
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263513424"
     variation       264
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775244207"
     variation       267
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771118232"
     variation       268
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747252575"
     variation       273
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868732343"
     exon            276..332
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       276
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750271640"
     variation       277
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:543487501"
     variation       278
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043343369"
     variation       279
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750268417"
     variation       290
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448020199"
     variation       291
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762865136"
     variation       294
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775330841"
     variation       296
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:148016416"
     variation       297
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750263924"
     variation       298..300
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="ttg"
                     /db_xref="dbSNP:779227890"
     variation       298
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454849271"
     variation       300
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144481454"
     variation       301
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150519689"
     variation       303
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745593902"
     variation       308..319
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aacactcaccga"
                     /db_xref="dbSNP:1242902542"
     variation       310..316
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="cac"
                     /replace="cactcac"
                     /db_xref="dbSNP:757802386"
     variation       310
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:946304876"
     variation       312
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138527872"
     variation       314
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339735347"
     variation       316
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2150519582"
     variation       317
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757907403"
     variation       318
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141548635"
     variation       322
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201709067"
     variation       329
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755596314"
     variation       330
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764377925"
     exon            333..405
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       334
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749320661"
     variation       335
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780631678"
     variation       339..343
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="ttgtt"
                     /db_xref="dbSNP:1750067937"
     variation       339
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1750068401"
     variation       347
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750067487"
     variation       349
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:532263854"
     variation       350
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1328421596"
     variation       351
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1750066060"
     variation       353
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1750065565"
     variation       354
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278922834"
     variation       359
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746283375"
     variation       362..364
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1388017290"
     variation       368
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781388497"
     variation       369
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751218204"
     variation       370
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406983239"
     variation       375
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391243960"
     variation       376..382
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tca"
                     /replace="tcagtca"
                     /db_xref="dbSNP:762598205"
     variation       376
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561685621"
     variation       377
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777349763"
     variation       378
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185445391"
     variation       379
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425260470"
     variation       383
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749780402"
     variation       384
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750057694"
     variation       386
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477188242"
     variation       387
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1750056781"
     variation       389
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750056286"
     variation       390..396
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:750256768"
     variation       392
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377608156"
     variation       396
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:549718297"
     variation       397
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750053838"
     variation       398
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759373577"
     variation       399
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753728671"
     variation       402
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1561685364"
     variation       405
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1693238677"
     exon            406..452
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       408
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438182467"
     variation       411
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:557986609"
     variation       413
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764452510"
     variation       415
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763064949"
     variation       416
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1483041739"
     variation       417
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1748212552"
     variation       420
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1748212077"
     variation       421..422
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1403653612"
     variation       425
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765236390"
     variation       426
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548653305"
     variation       428
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771385648"
     variation       429
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1286587676"
     variation       431
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138507676"
     variation       435
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314951065"
     variation       436
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974580309"
     variation       439
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773540586"
     variation       441..442
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1581021207"
     variation       442
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2150453321"
     variation       446
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1581021175"
     variation       448..449
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:779363914"
     variation       448..449
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1748205064"
     variation       449
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228585329"
     exon            453..535
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       455
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1393117032"
     variation       458
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180206825"
     variation       464
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150375703"
     variation       468
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773628734"
     variation       472
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237140365"
     variation       481
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1232231851"
     variation       483
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193606113"
     variation       484
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1745284481"
     variation       485
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547550705"
     variation       486
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1745283514"
     variation       488
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1186908669"
     variation       492
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748490924"
     variation       493
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773901255"
     variation       496
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2150375557"
     variation       502
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768317556"
     variation       503
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1561634678"
     variation       505
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748850005"
     variation       508
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745280061"
     variation       509
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145897680"
     variation       510
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753691260"
     variation       515
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376463567"
     variation       516
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327050486"
     variation       518..521
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="aaag"
                     /db_xref="dbSNP:2150375437"
     variation       523
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140748564"
     variation       525
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1286143770"
     variation       526
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1745276214"
     variation       527
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745797201"
     variation       528
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302333711"
     variation       530
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434037126"
     variation       532
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1580930674"
     variation       533
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:909927578"
     exon            536..634
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       538
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745248317"
     variation       539
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195109001"
     variation       540
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1745247359"
     variation       542
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185309293"
     variation       543
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755218264"
     variation       544
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138940796"
     variation       549
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1745244701"
     variation       551
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357350104"
     variation       552
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1265044045"
     variation       553
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:892129867"
     variation       554
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1561633837"
     variation       555
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867891240"
     variation       555
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1745242213"
     variation       556
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:780195488"
     variation       557..588
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ac"
                     /replace="acagcaacagataatggaatctcttaatgtac"
                     /db_xref="dbSNP:1745237533"
     variation       563
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157077028"
     variation       566
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363410017"
     variation       575
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756212865"
     variation       578
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750466231"
     variation       582
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325715984"
     variation       585
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767952170"
     variation       587
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406824741"
     variation       588
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1580929057"
     variation       590
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150254661"
     variation       592
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451415236"
     variation       593
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1745235605"
     variation       594
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1580928949"
     variation       595..596
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:749771436"
     variation       595
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751927567"
     variation       596
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141033147"
     variation       601
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775303734"
     variation       602
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1471995857"
     variation       608
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425234534"
     variation       610
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323742457"
     variation       612
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745230797"
     variation       616
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540839130"
     variation       617
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745229775"
     variation       620
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745229292"
     variation       621
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1475383930"
     variation       625
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1240814809"
     variation       626
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201507225"
     variation       627
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452590609"
     variation       631
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199710596"
     variation       632
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776182305"
     variation       633
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770828450"
     exon            635..761
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       638
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745162523"
     variation       641
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192069105"
     variation       654
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745161624"
     variation       657..660
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1238965408"
     variation       659
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745161152"
     variation       660
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752112029"
     variation       664
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1203948509"
     variation       666
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150372287"
     variation       669
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745159363"
     variation       672
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745158892"
     variation       675
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764451391"
     variation       676
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758865586"
     variation       677
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753079695"
     variation       681
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765028924"
     variation       683
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376864120"
     variation       692
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745154105"
     variation       695..697
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gag"
                     /db_xref="dbSNP:1231746887"
     variation       695
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216777810"
     variation       696
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745152720"
     variation       700
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378696125"
     variation       707
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538146502"
     variation       708
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868259372"
     variation       710
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745150168"
     variation       713
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1745149712"
     variation       714
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765914401"
     variation       715
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185768219"
     variation       718
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569355500"
     variation       719
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377239133"
     variation       720
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773227049"
     variation       722
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1745146291"
     variation       723
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745145818"
     variation       725
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172188810"
     variation       729
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866918568"
     variation       730
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771962047"
     variation       732
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774114264"
     variation       734
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176885832"
     variation       735
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468783521"
     variation       740
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770061194"
     variation       742
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151068525"
     variation       745
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781204320"
     variation       746
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759021447"
     variation       750..754
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1284629517"
     variation       752
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745140405"
     variation       756..760
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaa"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1745137975"
     variation       756
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757372616"
     variation       761
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409007703"
     exon            762..815
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       762
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213991862"
     variation       763..773
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aa"
                     /replace="aaaacattcaa"
                     /db_xref="dbSNP:1743744485"
     variation       766
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774200181"
     variation       768
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1270744844"
     variation       769
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1561615890"
     variation       771
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219885542"
     variation       775
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308635150"
     variation       781
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759382373"
     variation       792
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776934831"
     variation       793
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1580880398"
     variation       797
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376455824"
     variation       800
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743741013"
     variation       802
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747162578"
     variation       807
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743739935"
     variation       809
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440453004"
     variation       815
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777984796"
     exon            816..1125
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       816
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1742872861"
     variation       819..820
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="attg"
                     /db_xref="dbSNP:1742872594"
     variation       821
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203416589"
     variation       825
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1742872086"
     variation       827
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1257754270"
     variation       828
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1742871795"
     variation       830
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1742871636"
     variation       831
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264537272"
     variation       833
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:902115556"
     variation       837
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141113449"
     variation       839
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:984915490"
     variation       845..853
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tg"
                     /replace="tgatacatg"
                     /db_xref="dbSNP:771968649"
     variation       849
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1742870816"
     variation       851
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969146943"
     variation       854
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:541635390"
     variation       855
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023363430"
     variation       856
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1482647643"
     variation       866
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013697433"
     variation       872
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1040536560"
     variation       873
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377557125"
     variation       877
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1742868685"
     variation       879..882
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="atta"
                     /replace="attaatta"
                     /db_xref="dbSNP:1742868212"
     variation       879
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1742868478"
     variation       882
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1235330525"
     variation       886
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1742867726"
     variation       889
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1170023693"
     variation       891
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2150323462"
     variation       892
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1742867290"
     variation       893
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1561604899"
     variation       895
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150323454"
     variation       896
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1742866782"
     variation       903
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1561604890"
     variation       905
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1742866463"
     variation       909
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1395566343"
     variation       922..928
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="ttttaat"
                     /db_xref="dbSNP:1742866145"
     variation       930
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1742865928"
     variation       931
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1742865718"
     variation       932
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:960415421"
     variation       933
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1742865286"
     variation       937
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1742865081"
     variation       941
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1580855888"
     variation       942
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1031047258"
     variation       943..948
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aat"
                     /replace="aataat"
                     /db_xref="dbSNP:1290075532"
     variation       944
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008170348"
     variation       947
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889188814"
     variation       949
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359261220"
     variation       951
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1742863572"
     variation       952
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1044233351"
     variation       953
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:999452530"
     variation       955
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2150323388"
     variation       959
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1742863025"
     variation       961
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1742862888"
     variation       964
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:946829262"
     variation       965
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235494043"
     variation       967..968
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="ga"
                     /db_xref="dbSNP:1216623225"
     variation       967
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1742862413"
     variation       968
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257158346"
     variation       969
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1580855772"
     variation       971
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1742861660"
     variation       972
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2150323357"
     variation       978
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1742861452"
     variation       979
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271684867"
     variation       981
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528233561"
     variation       982
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006710585"
     variation       983
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382782475"
     variation       985
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1742860359"
     variation       988
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1742860172"
     variation       992..993
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1378546432"
     variation       992
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1742859963"
     variation       998
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1742859548"
     variation       999
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889228983"
     variation       1005
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150323315"
     variation       1007
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150323309"
     variation       1015
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334864048"
     variation       1016
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1050547626"
     variation       1017
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1742858629"
     variation       1018
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1742858329"
     variation       1021..1022
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1407159826"
     variation       1024
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750194911"
     variation       1025
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1742856967"
     variation       1032
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331066642"
     variation       1037
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2150323266"
     variation       1038
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1418807232"
     variation       1043
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1742856286"
     variation       1044
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559228580"
     variation       1053
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561604774"
     variation       1057
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:184796610"
     variation       1058
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73762017"
     variation       1061
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1742854506"
     variation       1067
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1742854285"
     variation       1068
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:182011671"
     variation       1074
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1401152017"
     variation       1077
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940981001"
     variation       1082
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1580855574"
     variation       1083
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:549176228"
     variation       1084
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423805760"
     variation       1085
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1742852727"
     variation       1087
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2150323187"
     variation       1093
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1742852508"
     variation       1101..1104
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="taac"
                     /db_xref="dbSNP:1742852298"
     regulatory      1106..1111
                     /regulatory_class="polyA_signal_sequence"
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="hexamer: AATATA"
     variation       1109
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114119671"
     variation       1110
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748849777"
     variation       1115
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753526956"
     variation       1116
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356918026"
     variation       1119
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412569901"
     variation       1121
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:970332536"
     variation       1123
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1742850695"
     polyA_site      1125
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="major polyA site"
ORIGIN      
gcagaagtccggggctggcaagcgcttcctgcgcagcgcctaggcgacctggagtttgtgacgctgtgatggtctagaggctggagattcaagatctgggtgccatcattttctggttctgttgatgaccctcttccaggttacatacagcttacatcttgcatcctcaagcggaggatctagatccggatagtactacagatgtgggagatgttacaaatactgaagaagaacttattagagaatgtgaagaaatgtggaaagatatggaagaatgtcagaataaattatcacttattggaactgaaacactcaccgattcaaatgctcagctatcattgttaattatgcaagtaaaatgtttaaccgctgaactcagtcaatggcagaaaaaaacacctgaaacaattcccttgactgaagacgttctcataacattaggaaaagaagagttccaaaagctgagacaagatcttgaaatggtactgtccactaaggagtcaaagaatgaaaagttaaaggaagacttagaaagggaacaacggtggttggatgaacagcaacagataatggaatctcttaatgtactacacagtgaattgaaaaataaggttgaaacattttctgaatcaagaatctttaatgaactgaaaactaaaatgcttaatataaaagaatataaggagaaactcttgagtaccttgggcgagtttctagaagaccattttcctctgcctgatagaagtgttaaaaagaaaaagaaaaacattcaagaatcatctgtaaacctgataacactgcatgaaatgttagaggtcctctctgccttggggtaaccactatttgatacatgctattatttttcatgttacgttatgattattctcttccatcatttgactgtgtccagaagatcatccattttaatgaatcttgttttgcaataatcagagagccaattcacatgatggtggattgttcgtatctgtttaatcctggtaagagagcagagacaatggaattgtacaagatgctggattaaacttagagaaggcagaaaagtggaagacaagaacaaaagatcgattaatagaaaacattaacaaatatagtaatttatatcaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]