2024-05-18 12:51:29, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_171275 1742 bp RNA linear VRT 24-SEP-2023 DEFINITION Gallus gallus notochord homeobox (NOTO), transcript variant 3, non-coding RNA. ACCESSION NR_171275 VERSION NR_171275.2 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1742) AUTHORS Tang H, Finn RD and Thomas PD. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1742) AUTHORS Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C, Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1742) AUTHORS Knezevic V, Ranson M and Mackem S. TITLE The organizer-associated chick homeobox gene, Gnot1, is expressed before gastrulation and regulated synergistically by activin and retinoic acid JOURNAL Dev Biol 171 (2), 458-470 (1995) PUBMED 7556928 REFERENCE 4 (bases 1 to 1742) AUTHORS Ranson M, Tickle C, Mahon KA and Mackem S. TITLE Gnot1, a member of a new homeobox gene subfamily, is expressed in a dynamic, region-specific domain along the proximodistal axis of the developing limb JOURNAL Mech Dev 51 (1), 17-30 (1995) PUBMED 7669689 REFERENCE 5 (bases 1 to 1742) AUTHORS Stein S and Kessel M. TITLE A homeobox gene involved in node, notochord and neural plate formation of chick embryos JOURNAL Mech Dev 49 (1-2), 37-48 (1995) PUBMED 7748788 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAENSK010000077.1. On Oct 26, 2021 this sequence version replaced NR_171275.1. ##Evidence-Data-START## Transcript exon combination :: U20615.1, SRR13267649.101144.1 [ECO:0000332] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-214 JAENSK010000077.1 3814748-3814961 c 215-423 JAENSK010000077.1 3813474-3813682 c 424-640 JAENSK010000077.1 3812907-3813123 c 641-1742 JAENSK010000077.1 3811485-3812586 c FEATURES Location/Qualifiers source 1..1742 /organism="Gallus gallus" /mol_type="transcribed RNA" /db_xref="taxon:9031" /chromosome="4" /map="4" gene 1..1742 /gene="NOTO" /gene_synonym="CNOT; GNOT1" /note="notochord homeobox" /db_xref="CGNC:49744" /db_xref="GeneID:396302" misc_RNA 1..1742 /gene="NOTO" /gene_synonym="CNOT; GNOT1" /product="notochord homeobox, transcript variant 3" /db_xref="GeneID:396302" /db_xref="CGNC:49744" exon 1..214 /gene="NOTO" /gene_synonym="CNOT; GNOT1" /inference="alignment:Splign:2.1.0" misc_feature 67..582 /gene="NOTO" /gene_synonym="CNOT; GNOT1" /inference="COORDINATES: alignment:Blast2seq::RefSeq|NM_001396848.1" /note="primary ORF has stop codon >50 nucleotides from the terminal splice site; nonsense-mediated decay (NMD) candidate" exon 215..423 /gene="NOTO" /gene_synonym="CNOT; GNOT1" /inference="alignment:Splign:2.1.0" exon 424..640 /gene="NOTO" /gene_synonym="CNOT; GNOT1" /inference="alignment:Splign:2.1.0" exon 641..1742 /gene="NOTO" /gene_synonym="CNOT; GNOT1" /inference="alignment:Splign:2.1.0" ORIGIN
tagcagctctccccttccgtcaccccatataaagccgtcgagccggccggcggcacccagccggccatgcctccccccaagacccccttccacatcgacgctctcctcgccgaacccccgcggcccggccccgcagcccccggcccgccgccccccatccctctccccacgccggggccaggagcctggagctggggctgccgctggggaggaggtctggagttgtctcactgcacaggggccgacccgctgggccctgctgtgctgtggaggtctggagggccctgcaaaatgaagagagtgcgcacagtcttcaaaccagagcagttggagaggctggagcaagagttcctcaagcagcagtacatggtgggcacagagcgagtggacctggctgcaacgctgcgtctcacagagacccaggtgaaagtctggttccagaaccggaggatcaaatggaggaagcagagcatggagcagaagaaggcaaagctgtcacagtttggggtgatacagcccacctctgctggccccacggatgtcaaggagcatgaggaggacacagtggaggttgagctttgagcagctgatgggatgcagctgccactgttgtttttgcagccacgcctgcctgatggaggtgactgtgtgctcctacgagggagagctgtgctgggaggagatttggctctgatggtttctcctggtcgtcttgattcccatgttggatgctgagatcacaacgacaacaaagtgaaaactgaaaagtcctttgctcccacccgcatcattcttatcattgttgtatttattttcatatatcattcatgcaataaggtgaacagggtctgactctgcccctggagtagaagcgcctctcctcctgtcctgtgccttgctgtcttgcctttcttttgcctttcagagcccagtgtggttttgccttacttcaccatggtgtgcacagggaacaaggggctcctggggctctcaaaggtgcagggaccagggccgttacaaaccagcagctcttcaacacctctgctgcgtcagacggccccctgccctcatccagatgttctggtcctggcccagatggcggctgctcccttctctccttgttacacaccacagcactgtgagaagcagcacctggagagcttggcgagtacatctgcaaccacacactgcagctcgctgtcgtattcctggtgggtgggagggctcggaggggtcaggactgagtattcacgtttccctgtctgtgttttagtaattcctaggggctggtgtgcacagcagcagcagcagcttttggccatgcagccggtgctcaggctgtcacctcatcccagggcaccaggcacaacatctcatgagctcaggataattcatcatgtctctttccaaccccagaatcatagaatcatagaatggcctgggttgaaaaggaccaccaatgatcacccaatttcaacccccctgctatgtgcagggtcgccaaccaccagaccaggctgcccagagccacatccagcctggccttgaatgcttccagggatggggcatccacagcctccttgggcaacctgttccagtgcgtcaccaccctctgagtggaaaaactgtatattgccttcctctagtgttagagagaaaagaaataacatttttttttctttcctccttgccaagtgtcacttctttatttgctttgcttctttaataaagaaagaaactgt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]