GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-18 17:15:24, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_205434               1964 bp    mRNA    linear   VRT 19-SEP-2023
DEFINITION  Gallus gallus homeobox D13 (HOXD13), mRNA.
ACCESSION   NM_205434 XM_429309
VERSION     NM_205434.1
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1964)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1964)
  AUTHORS   Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C,
            Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1964)
  AUTHORS   Bangs F, Welten M, Davey MG, Fisher M, Yin Y, Downie H, Paton B,
            Baldock R, Burt DW and Tickle C.
  TITLE     Identification of genes downstream of the Shh signalling in the
            developing chick wing and syn-expressed with Hoxd13 using
            microarray and 3D computational analysis
  JOURNAL   Mech Dev 127 (9-12), 428-441 (2010)
   PUBMED   20708683
  REMARK    GeneRIF: Hoxd13 and Sall1 are syn-expressed in the posterior region
            of early chick wing buds together with 6 novel genes which are
            likely to be functionally related and represent secondary targets
            of Shh signalling.
REFERENCE   4  (bases 1 to 1964)
  AUTHORS   Rogina B and Upholt WB.
  TITLE     Cloning of full coding chicken cDNAs for the homeobox-containing
            gene Hoxd-13
  JOURNAL   Nucleic Acids Res 21 (5), 1316 (1993)
   PUBMED   8096637
REFERENCE   5  (bases 1 to 1964)
  AUTHORS   Izpisua-Belmonte JC, Tickle C, Dolle P, Wolpert L and Duboule D.
  TITLE     Expression of the homeobox Hox-4 genes and the specification of
            position in chick wing development
  JOURNAL   Nature 350 (6319), 585-589 (1991)
   PUBMED   1673231
REFERENCE   6  (bases 1 to 1964)
  AUTHORS   Nohno T, Noji S, Koyama E, Ohyama K, Myokai F, Kuroiwa A, Saito T
            and Taniguchi S.
  TITLE     Involvement of the Chox-4 chicken homeobox genes in determination
            of anteroposterior axial polarity during limb development
  JOURNAL   Cell 64 (6), 1197-1205 (1991)
   PUBMED   1672266
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from L09550.1.
            
            On Aug 30, 2004 this sequence version replaced XM_429309.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: L09550.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA3109051, SAMN08016554
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1964
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="7"
                     /map="7"
                     /breed="Leghorn"
     gene            1..1964
                     /gene="HOXD13"
                     /gene_synonym="chox-4.8; chox-4G"
                     /note="homeobox D13"
                     /db_xref="CGNC:7049"
                     /db_xref="GeneID:396415"
     CDS             11..916
                     /gene="HOXD13"
                     /gene_synonym="chox-4.8; chox-4G"
                     /note="homeobox protein hoxd13; homeobox protein Hox-4G;
                     homeobox protein Hox-4.8; Hox D13"
                     /codon_start=1
                     /product="homeobox protein Hox-D13"
                     /protein_id="NP_990765.1"
                     /db_xref="CGNC:7049"
                     /db_xref="GeneID:396415"
                     /translation="
MDGLRGDSSGGGGGGGTPGQCRNFLSSPVFGAAHTGRAAAAAAAAASGFAYAGGGERSGAAARPDPPAKDCPGSGAPPAAPALGYGYHFGNGYYSCRMSNGVGIQQNALKSPPHASIGGFPVEKYMDVSSLTSTSVPANEVSTRAKEVSSYQGYTNPYQHVPGYIDMVSTFGSGEPRHETYISMEGYQSWTLANGWNGQVYCAKDQTQSSHFWKSSFPGDVALNQPEMCVYRRGRKKRVPYTKLQLKELENEYAINKFINKDKRRRISAATNLSERQVTIWFQNRRVKDKKIVSKLKDNVS"
     misc_feature    11..70
                     /gene="HOXD13"
                     /gene_synonym="chox-4.8; chox-4G"
                     /note="propagated from UniProtKB/Swiss-Prot (P24344.3);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    68..442
                     /gene="HOXD13"
                     /gene_synonym="chox-4.8; chox-4G"
                     /note="Hox protein A13 N terminal; Region: HoxA13_N;
                     pfam12284"
                     /db_xref="CDD:432453"
     misc_feature    173..235
                     /gene="HOXD13"
                     /gene_synonym="chox-4.8; chox-4G"
                     /note="propagated from UniProtKB/Swiss-Prot (P24344.3);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    order(713..727,731..733,782..784,800..802,839..841,
                     845..850,857..862,866..874,878..883)
                     /gene="HOXD13"
                     /gene_synonym="chox-4.8; chox-4G"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    719..880
                     /gene="HOXD13"
                     /gene_synonym="chox-4.8; chox-4G"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(719..721,728..730,848..850,857..862,869..871)
                     /gene="HOXD13"
                     /gene_synonym="chox-4.8; chox-4G"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     polyA_site      1218
                     /gene="HOXD13"
                     /gene_synonym="chox-4.8; chox-4G"
                     /note="alternate"
ORIGIN      
gggctgggagatggacggactgcgcggcgacagcagcggcggcggcggcggcggcggcacccccgggcagtgccgtaactttctctcctcgcccgttttcggcgcggcgcacacgggccgcgcggccgccgccgccgccgccgccgcctcggggttcgcctacgccggcggaggggagcgctcgggggcggcggcgcggcccgaccccccggccaaggactgcccgggctccggcgcgccgcccgccgcccccgcgctcggctacgggtatcactttggcaacggatactatagctgcaggatgtccaacggggttgggatccagcagaacgccctgaagtctcccccccatgcctccattggcggctttcccgtggaaaagtacatggacgtctccagtctgaccagcacgagtgtccccgccaatgaagtctccaccagggctaaagaagtgtcctcctaccagggctatacaaacccctaccagcacgttcctgggtacatagacatggtctcaacgtttggctctggggaaccgagacacgaaacgtacatatccatggagggctatcagtcctggactctggctaatggctggaacggccaggtgtactgtgccaaagatcagacacagagctcgcacttctggaaatcgtcctttccaggggacgttgcactaaaccagcccgagatgtgcgtctaccggcgcgggaggaagaagagagtgccctacaccaagctccagcttaaggaactcgagaacgaatacgccattaacaagttcattaacaaggacaagaggcgaaggatatccgcggccacgaacctgtccgaacgccaggtcaccatttggtttcagaacaggagggtgaaggataagaaaatagtctccaaactgaaagacaacgtttcttgatcgattccttgcggacagtggcggatatacaacctccgtttacgaccagctgcggacttttggaaagacttgaaaatatatttaatattttttttctcttctccttccagcggtggcgaagtttcgtgaattgttttctattcccgtgaaagccggcgttgttctctcggtggaagggagcgccgacaagccgtgactttagcgttgtttcttccttcctttttttaaaaaaaaataatattaatattaattatattttctatccttccctctaggccagtataaacgaatttaaacgtgtcgaacggttccatttataactttcttaaatgcttatctctttggggaggggacccggggtttttatctccgaacgtcggccggtgcccgaaagtgtcggactcgatttggtgtattggtcggaaaacgcgagtgagcgcgttcccgcagtcactgccggcaaaagccgcattgccggagtccgcacggggctccgcggatgtcggaagcagcggctccggaagggaattgtttgcactgcagtgggatcgctctttttattctttatgatttgattttgctggcgggcaatctgctaccggcttttcctggggtacggagcgcggcctcggctcctctcgttggatccgaaggggcagcgatgctccccgcagcagcgcccgggggtccctccggccgccccgtcccatcccgtcccgtcccgtcccgtcccgtcccgaggtgcgcacgtacctccgtgcggaccccgcgtgcgcataacgcacttcccggtcggagaagtgaagttcaccgctaactttcagtttgcaaaactaaacgggtgttaatgacagaagcaataaatgattcgtttcaaaagatgccataatttatgtaggccgaaaggctgggactcggttgggtttttgtaattttaaacctagcgtgcatgttatgctatacgcagggaggtcagctcctgggaaagagaagcgatgtcctccctgttcatgtgcctcgtgtaattattaaatggtgtgtgtttcga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]