GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-18 13:38:56, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_204765               1931 bp    mRNA    linear   VRT 19-SEP-2023
DEFINITION  Gallus gallus mesenchyme homeobox 1 (MEOX1), mRNA.
ACCESSION   NM_204765
VERSION     NM_204765.1
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1931)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1931)
  AUTHORS   Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C,
            Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1931)
  AUTHORS   Reijntjes S, Stricker S and Mankoo BS.
  TITLE     A comparative analysis of Meox1 and Meox2 in the developing somites
            and limbs of the chick embryo
  JOURNAL   Int J Dev Biol 51 (8), 753-759 (2007)
   PUBMED   17939123
  REMARK    GeneRIF: In the limb bud, Meox1 is co-expressed with Meox2 but
            neither Meox gene is co-expressed with MyoD, suggesting that these
            two genes have overlapping and distinct functions in development
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF043432.2.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF043432.2, BU263907.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA103992432, SAMEA103992440
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1931
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="27"
                     /map="27"
     gene            1..1931
                     /gene="MEOX1"
                     /gene_synonym="GGMOXR1"
                     /note="mesenchyme homeobox 1"
                     /db_xref="CGNC:810"
                     /db_xref="GeneID:395533"
     exon            1..644
                     /gene="MEOX1"
                     /gene_synonym="GGMOXR1"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    65..67
                     /gene="MEOX1"
                     /gene_synonym="GGMOXR1"
                     /note="upstream in-frame stop codon"
     CDS             218..940
                     /gene="MEOX1"
                     /gene_synonym="GGMOXR1"
                     /note="Mox-1 related protein; mesenchyme homeo box 1"
                     /codon_start=1
                     /product="homeobox protein MOX-1"
                     /protein_id="NP_990096.1"
                     /db_xref="CGNC:810"
                     /db_xref="GeneID:395533"
                     /translation="
MDPTGGSCMRSPQPPAPLWGCLRGADVPTAPGLGHCPPTPFSFHPKADFAAYSEFSASCLLSAAHCVPPEEQPPPFRPHPEWQQTATEARRLLSPGLALASGDAESPNLVSTAVAVSEDYKVPVNSGMETERKASKRKKEHSESQPSSSKAEGSSRSRKERTAFTKEQLRELEAEFAHHNYLTRLRRYEIAVNLDLTERQVKVWFQNRRMKWKRVKGGQPVSPPEPDAEDADSTTSPSSE"
     misc_feature    order(689..703,707..709,758..760,776..778,815..817,
                     821..826,833..838,842..850,854..859)
                     /gene="MEOX1"
                     /gene_synonym="GGMOXR1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(695..697,704..706,824..826,833..838,845..847)
                     /gene="MEOX1"
                     /gene_synonym="GGMOXR1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    698..856
                     /gene="MEOX1"
                     /gene_synonym="GGMOXR1"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     exon            645..817
                     /gene="MEOX1"
                     /gene_synonym="GGMOXR1"
                     /inference="alignment:Splign:2.1.0"
     exon            818..1931
                     /gene="MEOX1"
                     /gene_synonym="GGMOXR1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atcggccttgggaccctcttaggggcgatcgcctccttcacctattcgggacaatgaagacctttagaagagttccccaactaacaaacctccaacctcacaaaccccccagccaaagtgtcgcttagggaggaaatctgggctgtcaaatttggaaacattttcccctccgctcctctcctgctcgaggaacccgagtgacgaacgcgggacgaggatggaccccaccggaggcagctgcatgcgcagcccccaacccccagccccactctgggggtgcctacggggcgctgatgtccccacagccccagggttgggtcactgccccccgacccctttctccttccaccccaaggcggattttgctgcttattctgaattctcagcctcctgcttgctgagcgctgcccactgcgtcccacccgaggagcaaccgccaccgttccgtccccatcctgagtggcagcaaacagcaacagaggcccggagactgctgagcccagggctggcgttggcctctggggatgcagagagccccaacctcgtgagcacagcagtggctgtaagtgaagattacaaagtgccggtaaacagcgggatggagacggagagaaaggcatccaaaaggaaaaaggagcactcagaaagccagccctccagcagcaaggcagaaggcagcagcaggtcgcggaaggagaggacagcgttcaccaaggagcagctgagggagctggaggcagaatttgcccaccacaattacctgacaaggctcaggagatacgagatcgctgtgaacctggacctcaccgagagacaggtcaaagtgtggttccagaatagaaggatgaagtggaagcgcgttaagggggggcaaccagtgtcccctcctgagcccgatgcagaggacgccgactccaccacatcccccagctccgagtagtgccataaagagatgcttggagagggtgtgacactgcagaaggacactgcagctccatagggtggccctgtggggcacggactgagaggtgcgcagtgctggaactggcggagggaaatggaaagcacaaaataagccaaaggagagcaggactttgagctttgtgtgaatggaactgtcttactgccataggggtaccttcaccaaaaggagaaaaagaaaaaagataaaaaccactgtatatatagcaggagtaatgctgtttaggctcccaaatgctcagaaagtatgagttatcagttagaaagggaccagagggtgataacacagctctgttcacctccagcctttccctggtcacttcagctcatccttcacttggacttgggctctgagaatcactgaggttggaatagacctctcagaaccccaagtccaaccccaacccatcccaccgtgcccactgaccatgtctctacgtgccacattccccacatggggaggaacacctccagggatgggaacaccccaccccctgagcagctgtgccaatacccgacctctcttcctgagaacaaatttcacctcacatccaccctcaaagcagcccttaccaaacggcccctgcatcatttccatccttccactctggtttgcttccctatgtgatcatctccacctctgaaggtatccgactgatcccaggacactttaaagccaatttccaagtttaaagagtgcataaaagcagctttctagcataggatgaccacagcacccagacgtgaacgctccttcccttgcacactggtcctctcaacccatacctgtaatatagctaatgattacagtttaggaaagcatagtgtctgttcccatatcttctgtctttttgtttaacgttttctaatgcaactttatcatattttaaacagaactctacactggcatgtcatagaatggctattaaacacgacttttggtattctca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]