GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-18 17:15:21, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_001025355            1453 bp    mRNA    linear   VRT 19-SEP-2023
DEFINITION  Gallus gallus homeobox B5 (HOXB5), mRNA.
ACCESSION   NM_001025355 XM_422888
VERSION     NM_001025355.1
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1453)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1453)
  AUTHORS   Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C,
            Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1453)
  AUTHORS   Wedden SE, Pang K and Eichele G.
  TITLE     Expression pattern of homeobox-containing genes during chick
            embryogenesis
  JOURNAL   Development 105 (3), 639-650 (1989)
   PUBMED   2575515
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AY875647.1.
            
            On Jul 14, 2005 this sequence version replaced XM_422888.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY875647.1, AB193110.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA103992290, SAMEA103992323
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1453
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="27"
                     /map="27"
     gene            1..1453
                     /gene="HOXB5"
                     /gene_synonym="Ghox-2.1; Hoxb-5"
                     /note="homeobox B5"
                     /db_xref="CGNC:52343"
                     /db_xref="GeneID:425096"
     exon            1..607
                     /gene="HOXB5"
                     /gene_synonym="Ghox-2.1; Hoxb-5"
                     /inference="alignment:Splign:2.1.0"
     CDS             61..855
                     /gene="HOXB5"
                     /gene_synonym="Ghox-2.1; Hoxb-5"
                     /note="homeo box B5; homeobox protein Hox-2.1"
                     /codon_start=1
                     /product="homeobox protein Hox-B5"
                     /protein_id="NP_001020526.1"
                     /db_xref="CGNC:52343"
                     /db_xref="GeneID:425096"
                     /translation="
MSSYFVNSFSGRYPNGPDYQLLNYGTSSSMNGSYRDSSTMHSSSYGYNYNGMDLSINRSASSSHFGAVGESSRGFPSPAQESRFRQASSCSLSSPDSLPCSNSESHGGKPAPSPSDQATSASTNTNFTELDETSASSGADEGTPISSSIPRAQAEPIATSTAATEGQAPQIFPWMRKLHISHDMTGPDGKRARTAYTRYQTLELEKEFHFNRYLTRRRRIEIAHALCLSERQIKIWFQNRRMKWKKDNKLKSMSLASAGSAFQP"
     misc_feature    625..804
                     /gene="HOXB5"
                     /gene_synonym="Ghox-2.1; Hoxb-5"
                     /note="Region: homeobox"
     misc_feature    order(628..642,646..648,697..699,715..717,754..756,
                     760..765,772..777,781..789,793..798)
                     /gene="HOXB5"
                     /gene_synonym="Ghox-2.1; Hoxb-5"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(634..636,643..645,763..765,772..777,784..786)
                     /gene="HOXB5"
                     /gene_synonym="Ghox-2.1; Hoxb-5"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    637..795
                     /gene="HOXB5"
                     /gene_synonym="Ghox-2.1; Hoxb-5"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     exon            608..1453
                     /gene="HOXB5"
                     /gene_synonym="Ghox-2.1; Hoxb-5"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
cgtcaagcacagggttataacgaccacgagccacaaatcaagccctccaaaataacccaaatgagctcttactttgtaaactcgttctcagggcgctacccaaatggccccgactatcagttactaaattatgggaccagcagttccatgaacggttcttacagagattcaagcaccatgcattccagctcttatggctacaactacaatgggatggaccttagcatcaaccgctcagcctcctctagtcactttggggctgtgggggagagctcccgcggtttcccttctccagctcaggagagcaggtttagacaggcgtctagctgctccttatcttctcccgactcccttccctgctccaacagcgagagccatggaggcaagcccgccccgtccccctccgaccaagctacttctgccagcaccaacacaaatttcacagaactagacgagaccagcgcgtcctcgggagccgacgagggcactccaataagcagcagcatcccccgagcgcaggcagagcccatcgcaacctccacggcagcaacagaagggcaggcacctcagatattcccttggatgaggaaacttcacattagtcatgacatgactggaccagacgggaagagggcgaggacagcgtacactcgctaccagaccctggagttggaaaaggaattccacttcaatagatatctcacccgcaggaggagaatagagatcgctcacgctctgtgcctctccgagaggcagatcaaaatctggttccagaacaggaggatgaaatggaagaaggataataaactgaaaagcatgagcttagcttctgcgggcagcgcctttcagccataaattatagaggaaggaatatcgaggaaagaagaggaaacattaaataaatccgtaaataaataaagcgcagcagatcttagttttggagtactgtacagtgaggcaccttcttttcggcatgttgttgctattcgaaaccgacgcgtatggtacctttatcccaggactgagttcatgtcgtggttttttcttttttgggttgatttattaatttttttcctattatttttttttaattattattaaattttatttccagatgctccccatgctctcgttgtttttataaatgtacgtgtccgtgctatcttgatgctttctggaaagccagcatgttttatgtgagccctataaatgttataacttatttatgagatggtaacagataacgattgtttgtttatttgttgctttttccccttcctgagtttactgctttgggggtgagtttttctctgcctgagctaaaatcgggggttcctgcactacagtcgcagtaaaaaataataataagcaagaaaaaaaaacataaaaaagagggggaaaaaagagaaaaaaaagggggaaaaagattaaaaaaatttaaaaaggggaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]