2024-05-18 14:49:37, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001005427 2247 bp mRNA linear VRT 23-SEP-2023 DEFINITION Gallus gallus mesenchyme homeobox 2 (MEOX2), mRNA. ACCESSION NM_001005427 XM_418692 VERSION NM_001005427.2 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 2247) AUTHORS Tang H, Finn RD and Thomas PD. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 2247) AUTHORS Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C, Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 2247) AUTHORS Reijntjes S, Stricker S and Mankoo BS. TITLE A comparative analysis of Meox1 and Meox2 in the developing somites and limbs of the chick embryo JOURNAL Int J Dev Biol 51 (8), 753-759 (2007) PUBMED 17939123 REMARK GeneRIF: In the limb bud, Meox1 is co-expressed with Meox2 but neither Meox gene is co-expressed with MyoD, suggesting that these two genes have overlapping and distinct functions in development REFERENCE 4 (bases 1 to 2247) AUTHORS Rallis C, Stamataki D, Pontikakis S, Mankoo BS and Karagogeos D. TITLE Isolation of the avian homologue of the homeobox gene Mox2 and analysis of its expression pattern in developing somites and limbs JOURNAL Mech Dev 104 (1-2), 121-124 (2001) PUBMED 11404088 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from JAENSK010000036.1. On Sep 23, 2021 this sequence version replaced NM_001005427.1. ##Evidence-Data-START## Transcript exon combination :: SRR13267653.992.1, AJ401088.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA103992415 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-800 JAENSK010000036.1 20142710-20143509 c 801-973 JAENSK010000036.1 20104281-20104453 c 974-2247 JAENSK010000036.1 20090404-20091677 c FEATURES Location/Qualifiers source 1..2247 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="2" /map="2" gene 1..2247 /gene="MEOX2" /note="mesenchyme homeobox 2" /db_xref="CGNC:8206" /db_xref="GeneID:374137" exon 1..800 /gene="MEOX2" /inference="alignment:Splign:2.1.0" misc_feature 275..277 /gene="MEOX2" /note="upstream in-frame stop codon" CDS 290..1198 /gene="MEOX2" /note="mesenchyme homeo box 2 (growth arrest-specific homeo box)" /codon_start=1 /product="homeobox protein MOX-2" /protein_id="NP_001005427.2" /db_xref="CGNC:8206" /db_xref="GeneID:374137" /translation="
MDHTLFGCLRSPHATAQSLHPFSQSSLALHGRSDHMSYPDLSSSSSSCIITGYPNEEGMFASQHHRGHHHHHHHHHHHHQQQQHQALQTNWHIPQMSSPPAAARHSLCLQPDSGGPPELGSSPPVLCSNSSSLGTTTPTGAACAPGDYGRQALSPVETEKRSGKRKSDSSDSQEGNYKSEVNSKPRKERTAFTKEQIRELEAEFAHHNYLTRLRRYEIAVNLDLTERQVKVWFQNRRMKWKRVKGGQQGAAAREKELVNVKKGTLLPSELSGIGAAGLQHTGDSLANDDSHDSDHSSEHAHL"
misc_feature 758..1102 /gene="MEOX2" /note="Homeodomain-containing transcription factor [Transcription]; Region: COG5576" /db_xref="CDD:227863" misc_feature order(845..859,863..865,914..916,932..934,971..973, 977..982,989..994,998..1006,1010..1015) /gene="MEOX2" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature order(851..853,860..862,980..982,989..994,1001..1003) /gene="MEOX2" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 854..1012 /gene="MEOX2" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" exon 801..973 /gene="MEOX2" /inference="alignment:Splign:2.1.0" exon 974..2247 /gene="MEOX2" /inference="alignment:Splign:2.1.0" ORIGIN
aagcagttctctgggaccaccttctattggcttcaacctctcccacttcttgacatctgagcagctctgagaaaggctcatctaggtccgagtgtttatgcagcggagactggccgctagggctaaagacctggattatctgagctcagttgcctgctgcaaagtctgtcgttgccgttttggaaaaaaaaaatctcagccccgatctgtttacagtgaaagttgacaaagggtggtgaagttggatccttcctaaactctcctgcctggaacctgagacttgcatgccatggatcacacactctttggctgcctgcgcagcccccatgccaccgcgcagagcttgcatcctttctcccagtcttctcttgccctgcatggaagatccgaccacatgtcctaccccgatctgtcttcttcttcttcctcttgcataataacgggataccccaatgaggagggcatgtttgccagccagcatcatagggggcaccaccaccaccaccatcaccaccaccatcaccaccagcaacagcagcaccaggctttgcagacgaactggcacatccctcagatgtcgtctcctcccgccgcggccaggcacagcctctgtctccagccggactcaggaggacccccggagctgggcagcagcccccccgtgctgtgttcgaactcctccagcctgggcactaccacccccacgggggcagcgtgtgcgccgggggactatggcaggcaggctctgtccccggtggaaacggagaagaggtccggcaagaggaaaagcgacagctcagattcccaagaaggaaactacaagtcagaggtcaacagtaaacccaggaaggaaaggacagctttcaccaaggagcaaatcagagagctagaagcagaatttgctcatcataactatttgaccaggctgaggagatatgagatagcagtaaaccttgacctcactgaaagacaggtaaaagtttggttccagaacagacggatgaagtggaagcgggtaaaaggaggccagcaaggggcagcagcccgggaaaaggaactggtgaatgtgaaaaaaggcacgctgctcccctccgagctctctggcattggggcagctggtctccagcacacgggggactcactagcgaatgatgacagccacgacagcgatcacagctctgagcacgcacacttatgatacacagagagtgtcccagctccgttctcaggaaagatgctttgctggcaagccttacacaggcatcgtttacgtatgcaagtgactggcagtgatttttaaagttgttatggaagattcaggcttattgtgtctgtttttcttgatttttagatggtttacagtaagtgccatgtcttaaaggtgcctcaagagtggagaagtggaagatgaactttgaacattccagatttgtttgtcatgtttatgacagcgggcaggtattttgctttagcttgcactgaaaattacattgctctcaacagacgttatattctgaaaaccacagtgccacaaaatcactatctagtggataagaaatgtattttaactctgtatatatttaccttacagcattttcctgtcttcactaattttagcaatgcattcatattagctgatggcaatagtcactcatgacaataaatggctttttgtctctttaatttttgttttgtttcgccaaagacatacaatacatgcagatacttttgttcaagtagagaacgtatctgctaggacacgtccttgtatgacagacaaaacaaacattatgttgcatttactatcaactgctgctaatagggtattattaaacttacctagctcctcaattcttcttatcttataactgcaaaaaaatgatttttaggatcataaggatagtccagtaacctgccacaaaattttcatgctcagtggaaaccccagaaaggattattcatttctactttgtcatcactgagtacattaatactgactctgcggaaatgtctcttcatcttcagtttaaaaaacagcagtcagctgagttattatcaactgcttatgttggtaggaatcaaaatatgaaggtaactcagtattgtgtcccgtgtgtaaaatcaagacatattttctgttataagcttttgtgtacatacaggcaaacaccaaaactcaaaatttaatacaaaccattgattgtactttgtaaagaaaaatgtttaataaataatcatttttaaata
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]