GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-06-02 11:38:48, GGRNA.v2 : RefSeq release 223 (Mar, 2024)

LOCUS       NM_001368355            1946 bp    mRNA    linear   ROD 10-FEB-2024
DEFINITION  Mus musculus double C2, alpha (Doc2a), transcript variant 2, mRNA.
ACCESSION   NM_001368355
VERSION     NM_001368355.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1946)
  AUTHORS   Wang,Q.W., Qin,J., Chen,Y.F., Tu,Y., Xing,Y.Y., Wang,Y., Yang,L.Y.,
            Lu,S.Y., Geng,L., Shi,W., Yang,Y. and Yao,J.
  TITLE     16p11.2 CNV gene Doc2alpha functions in neurodevelopment and social
            behaviors through interaction with Secretagogin
  JOURNAL   Cell Rep 42 (7), 112691 (2023)
   PUBMED   37354460
  REMARK    GeneRIF: 16p11.2 CNV gene Doc2alpha functions in neurodevelopment
            and social behaviors through interaction with Secretagogin.
REFERENCE   2  (bases 1 to 1946)
  AUTHORS   Bourgeois-Jaarsma,Q., Miaja Hernandez,P. and Groffen,A.J.
  TITLE     Ca2+ sensor proteins in spontaneous release and synaptic
            plasticity: Limited contribution of Doc2c, rabphilin-3a and
            synaptotagmin 7 in hippocampal glutamatergic neurons
  JOURNAL   Mol Cell Neurosci 112, 103613 (2021)
   PUBMED   33753311
  REMARK    GeneRIF: Ca(2+) sensor proteins in spontaneous release and synaptic
            plasticity: Limited contribution of Doc2c, rabphilin-3a and
            synaptotagmin 7 in hippocampal glutamatergic neurons.
REFERENCE   3  (bases 1 to 1946)
  AUTHORS   Diez-Arazola,R., Meijer,M., Bourgeois-Jaarsma,Q., Cornelisse,L.N.,
            Verhage,M. and Groffen,A.J.
  TITLE     Doc2 Proteins Are Not Required for the Increased Spontaneous
            Release Rate in Synaptotagmin-1-Deficient Neurons
  JOURNAL   J Neurosci 40 (13), 2606-2617 (2020)
   PUBMED   32098902
  REMARK    GeneRIF: Doc2 Proteins Are Not Required for the Increased
            Spontaneous Release Rate in Synaptotagmin-1-Deficient Neurons.
REFERENCE   4  (bases 1 to 1946)
  AUTHORS   Bourgeois-Jaarsma,Q., Verhage,M. and Groffen,A.J.
  TITLE     Doc2b Ca2+ binding site mutants enhance synaptic release at rest at
            the expense of sustained synaptic strength
  JOURNAL   Sci Rep 9 (1), 14408 (2019)
   PUBMED   31594980
  REMARK    GeneRIF: Doc2b Ca(2+) binding site mutants enhance synaptic release
            at rest at the expense of sustained synaptic strength.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1946)
  AUTHORS   Courtney,N.A., Briguglio,J.S., Bradberry,M.M., Greer,C. and
            Chapman,E.R.
  TITLE     Excitatory and Inhibitory Neurons Utilize Different Ca2+ Sensors
            and Sources to Regulate Spontaneous Release
  JOURNAL   Neuron 98 (5), 977-991 (2018)
   PUBMED   29754754
  REMARK    GeneRIF: Doc2alpha promoted glutamatergic spontaneous
            neurotransmitter release, while Doc2beta and syt1 both regulated
            GABAergic spontaneous neurotransmitter release.
REFERENCE   6  (bases 1 to 1946)
  AUTHORS   Groffen,A.J., Friedrich,R., Brian,E.C., Ashery,U. and Verhage,M.
  TITLE     DOC2A and DOC2B are sensors for neuronal activity with unique
            calcium-dependent and kinetic properties
  JOURNAL   J Neurochem 97 (3), 818-833 (2006)
   PUBMED   16515538
REFERENCE   7  (bases 1 to 1946)
  AUTHORS   Toonen,R.F., de Vries,K.J., Zalm,R., Sudhof,T.C. and Verhage,M.
  TITLE     Munc18-1 stabilizes syntaxin 1, but is not essential for syntaxin 1
            targeting and SNARE complex formation
  JOURNAL   J Neurochem 93 (6), 1393-1400 (2005)
   PUBMED   15935055
REFERENCE   8  (bases 1 to 1946)
  AUTHORS   Bouwman,J., Maia,A.S., Camoletto,P.G., Posthuma,G., Roubos,E.W.,
            Oorschot,V.M., Klumperman,J. and Verhage,M.
  TITLE     Quantification of synapse formation and maintenance in vivo in the
            absence of synaptic release
  JOURNAL   Neuroscience 126 (1), 115-126 (2004)
   PUBMED   15145078
REFERENCE   9  (bases 1 to 1946)
  AUTHORS   Sakaguchi,G., Manabe,T., Kobayashi,K., Orita,S., Sasaki,T.,
            Naito,A., Maeda,M., Igarashi,H., Katsuura,G., Nishioka,H.,
            Mizoguchi,A., Itohara,S., Takahashi,T. and Takai,Y.
  TITLE     Doc2alpha is an activity-dependent modulator of excitatory synaptic
            transmission
  JOURNAL   Eur J Neurosci 11 (12), 4262-4268 (1999)
   PUBMED   10594652
REFERENCE   10 (bases 1 to 1946)
  AUTHORS   Naito,A., Orita,S., Wanaka,A., Sasaki,T., Sakaguchi,G., Maeda,M.,
            Igarashi,H., Tohyama,M. and Takai,Y.
  TITLE     Molecular cloning of mouse Doc2alpha and distribution of its mRNA
            in adult mouse brain
  JOURNAL   Brain Res Mol Brain Res 44 (2), 198-204 (1997)
   PUBMED   9073161
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC124505.4.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR7345562.3021039.1,
                                           SRR10662772.4242622.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN01164131, SAMN01164132
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-46                AC124505.4         188485-188530
            47-336              AC124505.4         189341-189630
            337-416             AC124505.4         189988-190067
            417-491             AC124505.4         190250-190324
            492-601             AC124505.4         190430-190539
            602-728             AC124505.4         191702-191828
            729-788             AC124505.4         191908-191967
            789-952             AC124505.4         192051-192214
            953-1034            AC124505.4         192305-192386
            1035-1131           AC124505.4         192477-192573
            1132-1946           AC124505.4         192659-193473
FEATURES             Location/Qualifiers
     source          1..1946
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="7"
                     /map="7 69.25 cM"
     gene            1..1946
                     /gene="Doc2a"
                     /note="double C2, alpha"
                     /db_xref="GeneID:13446"
                     /db_xref="MGI:MGI:109446"
     exon            1..46
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            47..336
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     CDS             60..1277
                     /gene="Doc2a"
                     /note="doc2-alpha"
                     /codon_start=1
                     /product="double C2-like domain-containing protein alpha"
                     /protein_id="NP_001355284.1"
                     /db_xref="CCDS:CCDS21847.1"
                     /db_xref="GeneID:13446"
                     /db_xref="MGI:MGI:109446"
                     /translation="
MRGRRGDRMTINIQEHMAINVCPGPIRPIRQISDYFPRRGPGPEGGGGGGGTGCGEAPAHLAPLALAPPAALLGATTPDDGAEVDSYDSDDTTALGTLEFDLLYDQASCMLHCRILRAKGLKPMDFNGLADPYVKLHLLPGACKANKLKTKTQRNTLNPVWNEELTYSGITDDDITHKVLRISVCDEDKLSHNEFIGEIRVPLRRLKPSQKKHFNICLERQVPLPSPSSMSAALRGISCYLKELEQAEQGPGLLEERGRILLSLSYSSRRHGLLVGIVRCAHLAAMDVNGYSDPYVKTYLRPDVDKKSKHKTCVKKKTLNPEFNEEFFYEIELSTLATKTLEVTVWDYDIGKSNDFIGGVSLGPGARGEAQKHWNDCLHQPDTALERWHTLTSELPPAAGAYPLA"
     misc_feature    60..341
                     /gene="Doc2a"
                     /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1);
                     Region: Interaction with UNC13D and DYNLT1.
                     /evidence=ECO:0000250"
     misc_feature    159..221
                     /gene="Doc2a"
                     /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    342..713
                     /gene="Doc2a"
                     /note="C2 domain first repeat present in Rabphilin and
                     Double C2 domain; Region: C2A_Rabphilin_Doc2; cd04035"
                     /db_xref="CDD:176000"
     misc_feature    order(432..434,450..452,615..617,621..623,639..641)
                     /gene="Doc2a"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:176000"
     misc_feature    717..1274
                     /gene="Doc2a"
                     /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1);
                     Region: Interaction with UNC13D. /evidence=ECO:0000250"
     misc_feature    834..1232
                     /gene="Doc2a"
                     /note="C2 domain second repeat present in Rabphilin and
                     Double C2 domain; Region: C2B_Rabphilin_Doc2; cd08384"
                     /db_xref="CDD:176030"
     misc_feature    order(918..920,936..938,1098..1100,1104..1106,1122..1124)
                     /gene="Doc2a"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:176030"
     exon            337..416
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            417..491
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            492..601
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            602..728
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            729..788
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            789..952
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            953..1034
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            1035..1131
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            1132..1946
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ggggaacaccgggcgcctctcgcggaggtgcacgccaagttctcggtcagaggtgctgcatgaggggccgcaggggcgatcgcatgaccatcaacatccaggagcacatggccatcaacgtgtgccctggacccatcaggcccatccgccagatctccgactacttccctcgcagggggccaggaccagagggtggcggcggcggcggtggcacgggctgcggggaagccccagctcatctggcccctctggctctggccccccctgcggctctccttggggccactacacccgacgatggagctgaggtagacagctacgactcggatgataccaccgccctgggcacactggaatttgaccttctctatgatcaggcttcctgcatgctgcactgtagaatcctcagggccaagggcctcaagcccatggatttcaatggcctggctgacccctatgtaaagcttcacctcctgccaggagcctgcaaggccaataagctaaaaaccaagacacagaggaacacactgaaccctgtgtggaatgaggagctgacgtacagcgggatcacggatgatgacatcacccacaaggtgctcaggatctctgtctgtgatgaggacaagctgagccacaatgaattcattggggagatccgagtgcccctccgccgcctcaagccttcacagaagaagcattttaacatctgccttgagcgccaggtcccgcttccttcaccctcttcaatgtctgcggcgctgaggggcatatcctgttacctgaaggagctggagcaggcagagcagggacctgggctgctggaagagcgcgggcgcatcctgctgagcctcagctacagctctcggcggcatgggctgctggtgggcattgttcgctgtgcgcacctggctgcaatggatgttaacggctactctgacccttatgtgaagacgtacttgagaccagatgtggataagaaatccaagcacaaaacatgtgtaaagaagaagacactaaatccggaatttaatgaggaattcttctatgagattgaactctccactctggccactaagaccctggaggtcacagtctgggactacgacattggcaaatccaatgacttcataggtggtgtgtctctggggccaggagcccggggagaggcccagaaacactggaatgactgtctacatcagccggacacagccctggagcgctggcatactctgaccagcgagctgccccctgcagcaggggcttaccctttggcttgagtgaacagcagctgtccatcacaggccctctggggccgggtccagtacccaaccttcgcacgagtgtgttgcacgtttacatggggtgggatgcccctgccccacactacctgtcttatttttgtgagtctctgtgacgggcctgtcttcttgtgagggactgtggagagctatattcacatatgcaaacttcctcctgcctgccttgctgttacctgcaaatatgcaaccacccgtgcacagggccacgtgggagtctcctgccagtgccccaccccatcctgcagctcctttcttggcctttccaggctgcctggtcccctgccccacagggagggggtcggattagggaagattagaggaggacgtttccaaatagaggaaaggacaaggaaagaaagagccaactctttaatacagagccttcactaaatcccagccctgcgtagctgctcttctaaaggggcggccaccgtaggtctctacctcccgaagatgtagcagacccttttggccactcgtttaaataactgttccctggatggggctgggatgtaagggcaggaccctgccaccttcctcggggacattgtgcatgtttacgccttttctgattgtgtcagtggccgaagcatggcaactgggcatcaataaacatctcttgaggaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]