2024-06-02 11:38:48, GGRNA.v2 : RefSeq release 223 (Mar, 2024)
LOCUS NM_001368355 1946 bp mRNA linear ROD 10-FEB-2024 DEFINITION Mus musculus double C2, alpha (Doc2a), transcript variant 2, mRNA. ACCESSION NM_001368355 VERSION NM_001368355.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1946) AUTHORS Wang,Q.W., Qin,J., Chen,Y.F., Tu,Y., Xing,Y.Y., Wang,Y., Yang,L.Y., Lu,S.Y., Geng,L., Shi,W., Yang,Y. and Yao,J. TITLE 16p11.2 CNV gene Doc2alpha functions in neurodevelopment and social behaviors through interaction with Secretagogin JOURNAL Cell Rep 42 (7), 112691 (2023) PUBMED 37354460 REMARK GeneRIF: 16p11.2 CNV gene Doc2alpha functions in neurodevelopment and social behaviors through interaction with Secretagogin. REFERENCE 2 (bases 1 to 1946) AUTHORS Bourgeois-Jaarsma,Q., Miaja Hernandez,P. and Groffen,A.J. TITLE Ca2+ sensor proteins in spontaneous release and synaptic plasticity: Limited contribution of Doc2c, rabphilin-3a and synaptotagmin 7 in hippocampal glutamatergic neurons JOURNAL Mol Cell Neurosci 112, 103613 (2021) PUBMED 33753311 REMARK GeneRIF: Ca(2+) sensor proteins in spontaneous release and synaptic plasticity: Limited contribution of Doc2c, rabphilin-3a and synaptotagmin 7 in hippocampal glutamatergic neurons. REFERENCE 3 (bases 1 to 1946) AUTHORS Diez-Arazola,R., Meijer,M., Bourgeois-Jaarsma,Q., Cornelisse,L.N., Verhage,M. and Groffen,A.J. TITLE Doc2 Proteins Are Not Required for the Increased Spontaneous Release Rate in Synaptotagmin-1-Deficient Neurons JOURNAL J Neurosci 40 (13), 2606-2617 (2020) PUBMED 32098902 REMARK GeneRIF: Doc2 Proteins Are Not Required for the Increased Spontaneous Release Rate in Synaptotagmin-1-Deficient Neurons. REFERENCE 4 (bases 1 to 1946) AUTHORS Bourgeois-Jaarsma,Q., Verhage,M. and Groffen,A.J. TITLE Doc2b Ca2+ binding site mutants enhance synaptic release at rest at the expense of sustained synaptic strength JOURNAL Sci Rep 9 (1), 14408 (2019) PUBMED 31594980 REMARK GeneRIF: Doc2b Ca(2+) binding site mutants enhance synaptic release at rest at the expense of sustained synaptic strength. Publication Status: Online-Only REFERENCE 5 (bases 1 to 1946) AUTHORS Courtney,N.A., Briguglio,J.S., Bradberry,M.M., Greer,C. and Chapman,E.R. TITLE Excitatory and Inhibitory Neurons Utilize Different Ca2+ Sensors and Sources to Regulate Spontaneous Release JOURNAL Neuron 98 (5), 977-991 (2018) PUBMED 29754754 REMARK GeneRIF: Doc2alpha promoted glutamatergic spontaneous neurotransmitter release, while Doc2beta and syt1 both regulated GABAergic spontaneous neurotransmitter release. REFERENCE 6 (bases 1 to 1946) AUTHORS Groffen,A.J., Friedrich,R., Brian,E.C., Ashery,U. and Verhage,M. TITLE DOC2A and DOC2B are sensors for neuronal activity with unique calcium-dependent and kinetic properties JOURNAL J Neurochem 97 (3), 818-833 (2006) PUBMED 16515538 REFERENCE 7 (bases 1 to 1946) AUTHORS Toonen,R.F., de Vries,K.J., Zalm,R., Sudhof,T.C. and Verhage,M. TITLE Munc18-1 stabilizes syntaxin 1, but is not essential for syntaxin 1 targeting and SNARE complex formation JOURNAL J Neurochem 93 (6), 1393-1400 (2005) PUBMED 15935055 REFERENCE 8 (bases 1 to 1946) AUTHORS Bouwman,J., Maia,A.S., Camoletto,P.G., Posthuma,G., Roubos,E.W., Oorschot,V.M., Klumperman,J. and Verhage,M. TITLE Quantification of synapse formation and maintenance in vivo in the absence of synaptic release JOURNAL Neuroscience 126 (1), 115-126 (2004) PUBMED 15145078 REFERENCE 9 (bases 1 to 1946) AUTHORS Sakaguchi,G., Manabe,T., Kobayashi,K., Orita,S., Sasaki,T., Naito,A., Maeda,M., Igarashi,H., Katsuura,G., Nishioka,H., Mizoguchi,A., Itohara,S., Takahashi,T. and Takai,Y. TITLE Doc2alpha is an activity-dependent modulator of excitatory synaptic transmission JOURNAL Eur J Neurosci 11 (12), 4262-4268 (1999) PUBMED 10594652 REFERENCE 10 (bases 1 to 1946) AUTHORS Naito,A., Orita,S., Wanaka,A., Sasaki,T., Sakaguchi,G., Maeda,M., Igarashi,H., Tohyama,M. and Takai,Y. TITLE Molecular cloning of mouse Doc2alpha and distribution of its mRNA in adult mouse brain JOURNAL Brain Res Mol Brain Res 44 (2), 198-204 (1997) PUBMED 9073161 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC124505.4. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: SRR7345562.3021039.1, SRR10662772.4242622.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN01164131, SAMN01164132 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-46 AC124505.4 188485-188530 47-336 AC124505.4 189341-189630 337-416 AC124505.4 189988-190067 417-491 AC124505.4 190250-190324 492-601 AC124505.4 190430-190539 602-728 AC124505.4 191702-191828 729-788 AC124505.4 191908-191967 789-952 AC124505.4 192051-192214 953-1034 AC124505.4 192305-192386 1035-1131 AC124505.4 192477-192573 1132-1946 AC124505.4 192659-193473 FEATURES Location/Qualifiers source 1..1946 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="7" /map="7 69.25 cM" gene 1..1946 /gene="Doc2a" /note="double C2, alpha" /db_xref="GeneID:13446" /db_xref="MGI:MGI:109446" exon 1..46 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 47..336 /gene="Doc2a" /inference="alignment:Splign:2.1.0" CDS 60..1277 /gene="Doc2a" /note="doc2-alpha" /codon_start=1 /product="double C2-like domain-containing protein alpha" /protein_id="NP_001355284.1" /db_xref="CCDS:CCDS21847.1" /db_xref="GeneID:13446" /db_xref="MGI:MGI:109446" /translation="
MRGRRGDRMTINIQEHMAINVCPGPIRPIRQISDYFPRRGPGPEGGGGGGGTGCGEAPAHLAPLALAPPAALLGATTPDDGAEVDSYDSDDTTALGTLEFDLLYDQASCMLHCRILRAKGLKPMDFNGLADPYVKLHLLPGACKANKLKTKTQRNTLNPVWNEELTYSGITDDDITHKVLRISVCDEDKLSHNEFIGEIRVPLRRLKPSQKKHFNICLERQVPLPSPSSMSAALRGISCYLKELEQAEQGPGLLEERGRILLSLSYSSRRHGLLVGIVRCAHLAAMDVNGYSDPYVKTYLRPDVDKKSKHKTCVKKKTLNPEFNEEFFYEIELSTLATKTLEVTVWDYDIGKSNDFIGGVSLGPGARGEAQKHWNDCLHQPDTALERWHTLTSELPPAAGAYPLA"
misc_feature 60..341 /gene="Doc2a" /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1); Region: Interaction with UNC13D and DYNLT1. /evidence=ECO:0000250" misc_feature 159..221 /gene="Doc2a" /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 342..713 /gene="Doc2a" /note="C2 domain first repeat present in Rabphilin and Double C2 domain; Region: C2A_Rabphilin_Doc2; cd04035" /db_xref="CDD:176000" misc_feature order(432..434,450..452,615..617,621..623,639..641) /gene="Doc2a" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:176000" misc_feature 717..1274 /gene="Doc2a" /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1); Region: Interaction with UNC13D. /evidence=ECO:0000250" misc_feature 834..1232 /gene="Doc2a" /note="C2 domain second repeat present in Rabphilin and Double C2 domain; Region: C2B_Rabphilin_Doc2; cd08384" /db_xref="CDD:176030" misc_feature order(918..920,936..938,1098..1100,1104..1106,1122..1124) /gene="Doc2a" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:176030" exon 337..416 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 417..491 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 492..601 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 602..728 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 729..788 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 789..952 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 953..1034 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 1035..1131 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 1132..1946 /gene="Doc2a" /inference="alignment:Splign:2.1.0" ORIGIN
ggggaacaccgggcgcctctcgcggaggtgcacgccaagttctcggtcagaggtgctgcatgaggggccgcaggggcgatcgcatgaccatcaacatccaggagcacatggccatcaacgtgtgccctggacccatcaggcccatccgccagatctccgactacttccctcgcagggggccaggaccagagggtggcggcggcggcggtggcacgggctgcggggaagccccagctcatctggcccctctggctctggccccccctgcggctctccttggggccactacacccgacgatggagctgaggtagacagctacgactcggatgataccaccgccctgggcacactggaatttgaccttctctatgatcaggcttcctgcatgctgcactgtagaatcctcagggccaagggcctcaagcccatggatttcaatggcctggctgacccctatgtaaagcttcacctcctgccaggagcctgcaaggccaataagctaaaaaccaagacacagaggaacacactgaaccctgtgtggaatgaggagctgacgtacagcgggatcacggatgatgacatcacccacaaggtgctcaggatctctgtctgtgatgaggacaagctgagccacaatgaattcattggggagatccgagtgcccctccgccgcctcaagccttcacagaagaagcattttaacatctgccttgagcgccaggtcccgcttccttcaccctcttcaatgtctgcggcgctgaggggcatatcctgttacctgaaggagctggagcaggcagagcagggacctgggctgctggaagagcgcgggcgcatcctgctgagcctcagctacagctctcggcggcatgggctgctggtgggcattgttcgctgtgcgcacctggctgcaatggatgttaacggctactctgacccttatgtgaagacgtacttgagaccagatgtggataagaaatccaagcacaaaacatgtgtaaagaagaagacactaaatccggaatttaatgaggaattcttctatgagattgaactctccactctggccactaagaccctggaggtcacagtctgggactacgacattggcaaatccaatgacttcataggtggtgtgtctctggggccaggagcccggggagaggcccagaaacactggaatgactgtctacatcagccggacacagccctggagcgctggcatactctgaccagcgagctgccccctgcagcaggggcttaccctttggcttgagtgaacagcagctgtccatcacaggccctctggggccgggtccagtacccaaccttcgcacgagtgtgttgcacgtttacatggggtgggatgcccctgccccacactacctgtcttatttttgtgagtctctgtgacgggcctgtcttcttgtgagggactgtggagagctatattcacatatgcaaacttcctcctgcctgccttgctgttacctgcaaatatgcaaccacccgtgcacagggccacgtgggagtctcctgccagtgccccaccccatcctgcagctcctttcttggcctttccaggctgcctggtcccctgccccacagggagggggtcggattagggaagattagaggaggacgtttccaaatagaggaaaggacaaggaaagaaagagccaactctttaatacagagccttcactaaatcccagccctgcgtagctgctcttctaaaggggcggccaccgtaggtctctacctcccgaagatgtagcagacccttttggccactcgtttaaataactgttccctggatggggctgggatgtaagggcaggaccctgccaccttcctcggggacattgtgcatgtttacgccttttctgattgtgtcagtggccgaagcatggcaactgggcatcaataaacatctcttgaggaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]