GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-19 00:39:50, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_057269599             621 bp    mRNA    linear   PLN 12-JUN-2023
DEFINITION  Penicillium waksmanii uncharacterized protein (N7481_010380),
            partial mRNA.
ACCESSION   XM_057269599
VERSION     XM_057269599.1
DBLINK      BioProject: PRJNA973687
            BioSample: SAMN30185384
KEYWORDS    RefSeq.
SOURCE      Penicillium waksmanii
  ORGANISM  Penicillium waksmanii
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae;
            Penicillium.
REFERENCE   1  (bases 1 to 621)
  AUTHORS   Petersen,C., Sorensen,T., Nielsen,M.R., Sondergaard,T.E.,
            Sorensen,J.L., Fitzpatrick,D.A., Frisvad,J.C. and Nielsen,K.L.
  TITLE     Comparative genomic study of the Penicillium genus elucidates a
            diverse pangenome and 15 lateral gene transfer events
  JOURNAL   IMA Fungus 14 (1), 3 (2023)
   PUBMED   36726175
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 621)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (09-JUN-2023) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 621)
  AUTHORS   Petersen,C.
  TITLE     Direct Submission
  JOURNAL   Submitted (12-JAN-2023) Department of Chemistry and Bioscience,
            Aalborg University, Fredrik Bajers Vej 7H, Aalborg, Nordjylland
            9220, Denmark
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_026643255).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..621
                     /organism="Penicillium waksmanii"
                     /mol_type="mRNA"
                     /strain="IBT 27052"
                     /culture_collection="IBT:27052"
                     /db_xref="taxon:69791"
                     /chromosome="Unknown"
     gene            <1..>621
                     /locus_tag="N7481_010380"
                     /db_xref="GeneID:81921380"
     CDS             1..621
                     /locus_tag="N7481_010380"
                     /note="Putative cyclase"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_057116773.1"
                     /db_xref="GeneID:81921380"
                     /translation="
MTQWDTHQPMVAGNTTFRTASYYISMSDHSGTHVDAPKHFDPTPGALSVDQMPLNEFYTEGICLDLSHAELGASIGVEEMESALLTSKQEIKQDDTVLLYMAYNERVSPEDPRWQHDFPGLAPESVHWLADRGCKIFGVEAVSPAPEGELNFIAHNICGERGITHIEGLDNLQSLLGRGRFRFIGFPLKLMGASGSPIRAVAVFEK"
     misc_feature    70..618
                     /locus_tag="N7481_010380"
                     /note="Kynurenine formamidase [Amino acid transport and
                     metabolism]; Region: COG1878"
                     /db_xref="CDD:224790"
ORIGIN      
atgactcaatgggacacacaccagccgatggttgcgggcaataccactttccgcaccgcttcctattacatctcaatgtctgatcattccggcacgcatgttgatgctccaaaacattttgacccaactcctggtgccctttctgtggatcaaatgcccttgaacgagttttataccgagggaatttgcctagatctcagccatgcggagctcggcgcatctattggcgttgaggaaatggagtccgccctccttacttctaaacaagagataaagcaagatgacacagtattactgtatatggcatacaacgaaagggtctccccggaggacccccgatggcagcatgatttccccggcctagcgccagaatcagtgcattggcttgctgacagaggttgcaaaatctttggcgttgaggctgtttcgcctgcacctgaaggtgaattgaacttcatcgcgcacaatatctgtggggagagaggcattacccatattgagggactcgacaatctacaatctcttcttgggcgtggaagatttcgatttattggtttcccgttaaagctcatgggcgctagtggaagtcctattagggccgtggctgtatttgaaaagtga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]