GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-18 23:56:45, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_041279492             543 bp    mRNA    linear   PLN 15-SEP-2021
DEFINITION  Brettanomyces bruxellensis uncharacterized protein (BRETT_000934),
            partial mRNA.
ACCESSION   XM_041279492
VERSION     XM_041279492.1
DBLINK      BioProject: PRJNA691332
            BioSample: SAMN12257691
KEYWORDS    RefSeq.
SOURCE      Brettanomyces bruxellensis
  ORGANISM  Brettanomyces bruxellensis
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Pichiaceae; Brettanomyces.
REFERENCE   1  (bases 1 to 543)
  AUTHORS   Roach,M.J. and Borneman,A.R.
  TITLE     New genome assemblies reveal patterns of domestication and
            adaptation across Brettanomyces (Dekkera) species
  JOURNAL   BMC Genomics 21 (1), 194 (2020)
   PUBMED   32122298
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 543)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (15-SEP-2021) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 543)
  AUTHORS   Palmer,J.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (19-OCT-2020) CFMR, USDA Forest Service, 1 Gifford
            Pinchot Drive, Madison, WI 53726, USA
REFERENCE   4  (bases 1 to 543)
  AUTHORS   Roach,M.J. and Borneman,A.R.
  TITLE     Direct Submission
  JOURNAL   Submitted (07-AUG-2019) Research, Australian Wine Research
            Institute, Corner of Hartley Grove and Paratoo Road, Urrbrae, SA
            5064, Australia
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_054689).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..543
                     /organism="Brettanomyces bruxellensis"
                     /mol_type="mRNA"
                     /strain="UCD 2041"
                     /isolation_source="fruit wine"
                     /culture_collection="AWRI:2804"
                     /db_xref="taxon:5007"
                     /chromosome="8"
                     /country="Thailand"
                     /collection_date="06-Aug-2013"
     gene            <1..>543
                     /locus_tag="BRETT_000934"
                     /db_xref="GeneID:64572859"
     CDS             1..543
                     /locus_tag="BRETT_000934"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_041137706.1"
                     /db_xref="GeneID:64572859"
                     /translation="
MVAYQFSSVCENCELNVNMSDSDKTDKKFPRSSLSRTTTTTSITTPVHPMELVVQSLLESPLELLNLSIHSLYESQMILTTILDRMQRKLDKCLRGIGKSRQEPITTDTDTQNLQYPNEHRNRANSDDDLTTQPGPDKSLTIEEYAARIHTIKLRIVKIHDTLDHVEKKIAQINTNLSSA"
ORIGIN      
atggttgcataccaatttagttccgtttgtgagaattgtgaactaaatgtgaacatgagtgactcagataaaacagacaagaaatttccacgctcttctctttccagaacaactacaacgactagcataactacccctgttcacccaatggaattggttgtacaatctcttcttgaatcacctcttgagcttctaaatttgagtattcattcattgtatgaatcgcaaatgattctcacaacaatattagatcgaatgcagcggaaacttgacaaatgtcttaggggcattggtaaaagtaggcaagaaccaattactactgacacagatacgcaaaatttacaatatccaaacgagcatcgaaatagggcaaactcagatgatgatctgacaacacagccaggaccagacaaaagcttgacaattgaagaatatgctgccagaattcatacgatcaagctccgcattgtaaaaattcatgacacattggaccacgtggaaaagaagattgcgcagataaatacgaatctttcctccgcctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]