GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-18 18:21:55, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_001025225            1218 bp    mRNA    linear   MAM 18-DEC-2022
DEFINITION  Sus scrofa aurora kinase A (AURKA), mRNA.
ACCESSION   NM_001025225
VERSION     NM_001025225.1
KEYWORDS    RefSeq.
SOURCE      Sus scrofa (pig)
  ORGANISM  Sus scrofa
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae;
            Sus.
REFERENCE   1  (bases 1 to 1218)
  AUTHORS   Komrskova P, Susor A, Malik R, Prochazkova B, Liskova L, Supolikova
            J, Hladky S and Kubelka M.
  TITLE     Aurora kinase A is not involved in CPEB1 phosphorylation and cyclin
            B1 mRNA polyadenylation during meiotic maturation of porcine
            oocytes
  JOURNAL   PLoS One 9 (7), e101222 (2014)
   PUBMED   24983972
  REMARK    GeneRIF: Aurora kinase A is unlikely to be involved in CPEB1
            activating phosphorylation and cyclin B1 mRNA polyadenylation
            during meiotic maturation of porcine oocytes.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1218)
  AUTHORS   Nishimura Y, Kano K and Naito K.
  TITLE     Porcine CPEB1 is involved in Cyclin B translation and meiotic
            resumption in porcine oocytes
  JOURNAL   Anim Sci J 81 (4), 444-452 (2010)
   PUBMED   20662813
REFERENCE   3  (bases 1 to 1218)
  AUTHORS   Nishimura Y, Endo T, Kano K and Naito K.
  TITLE     Porcine Aurora A accelerates Cyclin B and Mos synthesis and
            promotes meiotic resumption of porcine oocytes
  JOURNAL   Anim Reprod Sci 113 (1-4), 114-124 (2009)
   PUBMED   18614302
  REMARK    GeneRIF: Aurora A stimulates the protein synthesis and promotes the
            meiotic resumption.
REFERENCE   4  (bases 1 to 1218)
  AUTHORS   Yao LJ and Sun QY.
  TITLE     Characterization of aurora-a in porcine oocytes and early embryos
            implies its functional roles in the regulation of meiotic
            maturation, fertilization and cleavage
  JOURNAL   Zygote 13 (1), 23-30 (2005)
   PUBMED   15984158
  REMARK    GeneRIF: Aurora-A may be a multifunctional kinase that plays
            pivotal regulatory roles in microtubule assembly during porcine
            oocyte meiotic maturation, fertilization and early embryonic
            mitosis
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AB196773.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB196773.1, SRR5120059.330090.1
                                           [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA103886111, SAMEA103886112
                                           [ECO:0000350]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1218
                     /organism="Sus scrofa"
                     /mol_type="mRNA"
                     /db_xref="taxon:9823"
                     /chromosome="17"
                     /map="17"
     gene            1..1218
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="aurora kinase A"
                     /db_xref="GeneID:574063"
     CDS             1..1218
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /EC_number="2.7.11.1"
                     /note="serine/threonine kinase 6; aurora-A;
                     Serine/threonine-protein kinase 6;
                     serine/threonine-protein kinase aurora-A; aurora 2;
                     aurora-related kinase 1; aurora/IPL1-related kinase 1;
                     serine/threonine-protein kinase 15; ipl1- and
                     aurora-related kinase 1; serine/threonine-protein kinase
                     Ayk1"
                     /codon_start=1
                     /product="aurora kinase A"
                     /protein_id="NP_001020396.1"
                     /db_xref="GeneID:574063"
                     /translation="
MDKCKENCISGLKTTVPPGDGPKRVPVTQHFPAQHLPSANSGQAQRVLCPSNSSQRLPSHTQKLVSSHKPVQNLKQKQSQATSGPRPVSRPLSNTQQSEQPQPAAPGNNPEKEAASKQKNEESKKRQWALEDFEIGRPLGKGKFGNVYLAREKQSKFILALKVLFKTQLEKAGVEHQLRREVEIQSHLRHPNILRLYGYFHDATRVYLILEYAPLGAVYRELRELQKLSKFDEQRTATYITELANALSYCHSKRVIHRDIKPENLLLGSAGELKIADFGWSVHAPSSRRTTLCGTLDYLPPEMIEGRMHDEKVDLWSLGVLCYEFLVGKPPFEANTYQETYKRISRVEFTFPDFAPEGARDLISRLLKHNPSHRPTLKEVLEHPWITANSKPASSHKKESTSKQP"
     misc_feature    1..375
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="propagated from UniProtKB/Swiss-Prot (A5GFW1.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    121..123
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:O14965; propagated from
                     UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site"
     misc_feature    151..153
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:O14965; propagated from
                     UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site"
     misc_feature    379..1161
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="Protein Kinases, catalytic domain; Region:
                     PKc_like; cl21453"
                     /db_xref="CDD:451246"
     misc_feature    order(415..426,433..435,439..441,478..480,484..486,
                     580..582,628..639,775..777,787..792,796..798,826..831)
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    847..888
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="propagated from UniProtKB/Swiss-Prot (A5GFW1.1);
                     Region: Activation segment.
                     /evidence=ECO:0000250|UniProtKB:O14965"
     misc_feature    868..870
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:O14965; propagated from
                     UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site"
     misc_feature    871..873
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:O14965; propagated from
                     UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site"
     misc_feature    1033..1035
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /note="Phosphoserine, by PKA and PAK.
                     /evidence=ECO:0000250|UniProtKB:O14965; propagated from
                     UniProtKB/Swiss-Prot (A5GFW1.1); phosphorylation site"
     exon            1..39
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /inference="alignment:Splign:2.1.0"
     exon            40..319
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /inference="alignment:Splign:2.1.0"
     exon            320..374
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /inference="alignment:Splign:2.1.0"
     exon            375..566
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /inference="alignment:Splign:2.1.0"
     exon            567..714
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /inference="alignment:Splign:2.1.0"
     exon            715..863
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /inference="alignment:Splign:2.1.0"
     exon            864..1038
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /inference="alignment:Splign:2.1.0"
     exon            1039..1218
                     /gene="AURKA"
                     /gene_synonym="ARK-1; STK6"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atggacaaatgtaaagaaaactgcatttcggggcttaagaccacagttccacctggcgatggtccaaaacgggttccagtgacccagcactttccagctcagcatctgccgtctgcaaacagcggccaggcccagcgggtcttatgtccttcgaattcctcacagcgcctgccttcgcacacgcagaagctcgtctccagccataaaccagttcagaatctgaagcagaagcagtcgcaggcaaccagtggccctcgtcctgtctccaggcctctgagtaacacccagcagagtgagcagccccagccggcagcgcctggaaacaatcctgaaaaggaagcggcatcaaaacagaaaaatgaagaatcaaaaaaaaggcaatgggctttggaagattttgaaattggccgcccgctgggtaaaggaaagtttggtaatgtttatttagcaagagaaaaacaaagcaagtttatcctggctcttaaagtattgtttaaaactcagctggagaaggcaggagttgagcatcagctgagaagagaagtagaaatacagtcccaccttaggcatccaaatattctcagactgtatggttatttccatgacgctaccagagtttacctaatcctggaatacgcacctctcggagctgtctatagagaacttagagaacttcagaaactgtcaaagtttgatgagcagagaactgctacttatatcacagaattggcaaatgccctatcttactgtcactcaaagagagttattcacagagacattaagccagagaacctgctccttggatccgctggagagcttaagattgccgattttgggtggtcggtccatgccccgtcctccaggagaaccaccctctgcggcaccctggactacttgccccccgagatgatcgaaggccggatgcatgacgagaaggtggatctctggagcttgggggtgctttgctatgaattcctggttgggaagcccccctttgaggcaaacacgtaccaagagacctacaaaaggatatcccgggtggaattcaccttccctgactttgcgcccgagggagccagggacctcatctcaagactattgaagcacaaccccagccacaggcccaccctcaaggaggtgctcgaacacccctggatcaccgccaattccaagccagcaagtagtcacaaaaaagaatccaccagcaagcaaccctaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]