2024-05-17 15:54:33, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_132637 594 bp RNA linear ROD 25-FEB-2022 DEFINITION Rattus norvegicus homeobox B5 and homeobox B6, opposite strand (Hoxb5os), long non-coding RNA. ACCESSION NR_132637 VERSION NR_132637.1 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JACYVU010000220.1. Sequence Note: This RefSeq record was created from genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments and orthologous data. ##Evidence-Data-START## Transcript exon combination :: CB734164.1 [ECO:0000332] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-169 JACYVU010000220.1 38097437-38097605 c 170-348 JACYVU010000220.1 38084077-38084255 c 349-594 JACYVU010000220.1 38081738-38081983 c FEATURES Location/Qualifiers source 1..594 /organism="Rattus norvegicus" /mol_type="transcribed RNA" /strain="BN" /db_xref="taxon:10116" /chromosome="10" /map="10q26" gene 1..594 /gene="Hoxb5os" /note="homeobox B5 and homeobox B6, opposite strand" /db_xref="GeneID:106455138" /db_xref="RGD:10395317" ncRNA 1..594 /ncRNA_class="lncRNA" /gene="Hoxb5os" /product="homeobox B5 and homeobox B6, opposite strand" /db_xref="GeneID:106455138" /db_xref="RGD:10395317" exon 1..169 /gene="Hoxb5os" /inference="alignment:Splign:2.1.0" exon 170..348 /gene="Hoxb5os" /inference="alignment:Splign:2.1.0" exon 349..594 /gene="Hoxb5os" /inference="alignment:Splign:2.1.0" ORIGIN
atgtcatagcgacttttggggtagtttgctttcggcaaagggggacaaagtcatggggtgagagggaaggagggcccaatgcagcctccaagaccctcaccatctcttcaccggctccccccccccaggtcctgtaagaagttgggcccagctggaagggattgaccggaagcctcctcgccctcggctggcctctgcggagattccaggccccacagagaccaggacgtccctcagcgccaccgcccctcgtgccaatgcagccgggaaatcgccgttacccacactgggcaagagaaccgcacgggggcaatcggggaggccaggacaagggaaaagtggagggagaaggttccaggttggccgtattcaagagcaggctgagcagcgcagaggaagccctggcggcgccggcgctgccaagcttactgcgtccacccaccccagcccggtaaactctccgtcgctcatggggactggttttcctcccattttaaaattttatatggatagcccatgtcaatttagaatgaaatagattttaatacactaagtaaaaacaaattgaaataaaataaaggaatcactccaacg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]