GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-17 13:09:36, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_204202               1175 bp    mRNA    linear   VRT 23-SEP-2023
DEFINITION  Gallus gallus claudin 3 (CLDN3), mRNA.
ACCESSION   NM_204202
VERSION     NM_204202.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1175)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1175)
  AUTHORS   Danzinger S, Tan YY, Rudas M, Kastner MT, Weingartshofer S, Muhr D
            and Singer CF.
  CONSRTM   kConFab Investigators
  TITLE     Differential Claudin 3 and EGFR Expression Predicts BRCA1 Mutation
            in Triple-Negative Breast Cancer
  JOURNAL   Cancer Invest 36 (7), 378-388 (2018)
   PUBMED   30142017
  REMARK    GeneRIF: CLDN3 expression and negative EGFR expression are
            associated with BRCA1 mutations in triple-negative breast cancers.
REFERENCE   3  (bases 1 to 1175)
  AUTHORS   Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C,
            Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1175)
  AUTHORS   Haddad N, El Andalousi J, Khairallah H, Yu M, Ryan AK and Gupta IR.
  TITLE     The tight junction protein claudin-3 shows conserved expression in
            the nephric duct and ureteric bud and promotes tubulogenesis in
            vitro
  JOURNAL   Am J Physiol Renal Physiol 301 (5), F1057-F1065 (2011)
   PUBMED   21775479
  REMARK    GeneRIF: Cldn3 may therefore promote tubule formation and expansion
            of the ureteric bud epithelium
REFERENCE   5  (bases 1 to 1175)
  AUTHORS   Haworth KE, El-Hanfy A, Prayag S, Healy C, Dietrich S and Sharpe P.
  TITLE     Expression of Claudin-3 during chick development
  JOURNAL   Gene Expr Patterns 6 (1), 40-44 (2005)
   PUBMED   16024293
  REMARK    GeneRIF: The early expression domains of Claudin 3 in the
            developing chick embryo include the mesoderm surrounding Hensen's
            node and the head fold.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAENSK010000323.1.
            
            On Oct 18, 2021 this sequence version replaced NM_204202.1.
            
            ##Evidence-Data-START##
            Transcript is intronless :: AF334677.1, BM490185.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1175              JAENSK010000323.1  695137-696311       c
FEATURES             Location/Qualifiers
     source          1..1175
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="19"
                     /map="19"
     gene            1..1175
                     /gene="CLDN3"
                     /gene_synonym="claudin-3"
                     /note="claudin 3"
                     /db_xref="CGNC:49012"
                     /db_xref="GeneID:374029"
     exon            1..1175
                     /gene="CLDN3"
                     /gene_synonym="claudin-3"
                     /inference="alignment:Splign:2.1.0"
     CDS             87..731
                     /gene="CLDN3"
                     /gene_synonym="claudin-3"
                     /codon_start=1
                     /product="claudin-3"
                     /protein_id="NP_989533.1"
                     /db_xref="CGNC:49012"
                     /db_xref="GeneID:374029"
                     /translation="
MSMGLEIGGVALSVLGWLCSIICCALPMWRVTAFIGNNIVTAQIIWEGLWMNCVVQSTGQMQCKVYDSMLALPQDLQAARALLVVAIVLAVLGLMVAIVGAQCTRCVEDETTKAKITIVSGVIFLLSGIMTLIPVSWSANTIIRDFYNPLVIDAQKRELGTSLYVGWAASALLLFGGALLCCSCPPKDERYAPSKVAYSAPRSAVTSYDKRNYV"
     misc_feature    93..593
                     /gene="CLDN3"
                     /gene_synonym="claudin-3"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:451326"
ORIGIN      
gatccccacggctgcagcagcgagcggagcacagggtggtttcggtcagcgggttcctctctgccatcgcccgggagccggacaccatgtctatggggctggagatcggtggggtggccctgtcggtgctgggctggctgtgcagcatcatctgctgcgcgctgcccatgtggagggtgacggccttcatcggcaacaacatcgtgacggcgcagatcatctgggaagggctgtggatgaactgcgtggtgcagagcacggggcagatgcagtgcaaggtgtacgactccatgctggccctgccgcaggacctgcaggccgcccgcgcgctgctggtggtggccatcgtgctggccgtgctgggcctgatggtggccatcgtgggcgcccagtgcacgcgctgcgtggaggacgagaccaccaaggccaagatcaccatcgtctccggcgtcatcttcctgctctccggcatcatgaccctcatccccgtctcctggtcggccaacaccatcatccgggatttctacaacccgctggtgatcgacgctcagaagcgggagctgggcacgtccctctacgtgggctgggcggcctccgcgctgctgctctttgggggggccctgctgtgctgctcctgcccccccaaagacgagaggtacgcgcccagcaaggtggcttactccgccccgcgctccgccgttaccagctacgacaagaggaactatgtgtgagccccccgcgccccccggcccagccctatggggggctcagccgcccccgcgcccacttccagccccaccgccgggaccgccaccgccggggaccctccgccccgcgggccggggagagagctcctgtccccgagggtgcccagcacggtgggagcaggcggggaaatgaagggggggcgatgggatcggtgccggggtcagggccgggcagtgtgagcgggagccgggcgggcggctgtgtcaatactgatggtttcatgtaaacagagccggtttcgggttgccaggagagctgtgtgcagcagcaccaggaggaagctccgtgccccccccgccctgccccgccggcccccccgggaccccccgccggccgggcaccttctctccctgttacgcgtggtctgtacaagttacatttgtcaataaaggaatcctgttttggta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]