2024-05-16 23:02:30, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001113526 849 bp mRNA linear VRT 05-AUG-2023 DEFINITION Danio rerio H6 family homeobox 1 (hmx1), mRNA. ACCESSION NM_001113526 XM_001334293 VERSION NM_001113526.1 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 849) AUTHORS El Fersioui Y, Pinton G, Allaman-Pillet N and Schorderet DF. TITLE Premature Vertebral Mineralization in hmx1-Mutant Zebrafish JOURNAL Cells 11 (7), 1088 (2022) PUBMED 35406651 REMARK GeneRIF: Premature Vertebral Mineralization in hmx1-Mutant Zebrafish. Publication Status: Online-Only REFERENCE 2 (bases 1 to 849) AUTHORS Spead O, Weaver CJ, Moreland T and Poulain FE. TITLE Live imaging of retinotectal mapping reveals topographic map dynamics and a previously undescribed role for Contactin 2 in map sharpening JOURNAL Development 148 (22) (2021) PUBMED 34698769 REFERENCE 3 (bases 1 to 849) AUTHORS Farnsworth DR, Posner M and Miller AC. TITLE Single cell transcriptomics of the developing zebrafish lens and identification of putative controllers of lens development JOURNAL Exp Eye Res 206, 108535 (2021) PUBMED 33705730 REFERENCE 4 (bases 1 to 849) AUTHORS El Fersioui Y, Pinton G, Allaman-Pillet N and Schorderet DF. TITLE Hmx1 regulates urfh1 expression in the craniofacial region in zebrafish JOURNAL PLoS One 16 (1), e0245239 (2021) PUBMED 33465110 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 849) AUTHORS England SJ, Cerda GA, Kowalchuk A, Sorice T, Grieb G and Lewis KE. TITLE Hmx3a Has Essential Functions in Zebrafish Spinal Cord, Ear and Lateral Line Development JOURNAL Genetics 216 (4), 1153-1185 (2020) PUBMED 33077489 REFERENCE 6 (bases 1 to 849) AUTHORS Boisset G and Schorderet DF. TITLE Zebrafish hmx1 promotes retinogenesis JOURNAL Exp Eye Res 105, 34-42 (2012) PUBMED 23068565 REFERENCE 7 (bases 1 to 849) AUTHORS Gongal PA, March LD, Holly VL, Pillay LM, Berry-Wynne KM, Kagechika H and Waskiewicz AJ. TITLE Hmx4 regulates Sonic hedgehog signaling through control of retinoic acid synthesis during forebrain patterning JOURNAL Dev Biol 355 (1), 55-64 (2011) PUBMED 21539831 REFERENCE 8 (bases 1 to 849) AUTHORS Feng Y and Xu Q. TITLE Pivotal role of hmx2 and hmx3 in zebrafish inner ear and lateral line development JOURNAL Dev Biol 339 (2), 507-518 (2010) PUBMED 20043901 REFERENCE 9 (bases 1 to 849) AUTHORS Wotton KR, Weierud FK, Juarez-Morales JL, Alvares LE, Dietrich S and Lewis KE. TITLE Conservation of gene linkage in dispersed vertebrate NK homeobox clusters JOURNAL Dev Genes Evol 219 (9-10), 481-496 (2009) PUBMED 20112453 REFERENCE 10 (bases 1 to 849) AUTHORS Schorderet DF, Nichini O, Boisset G, Polok B, Tiab L, Mayeur H, Raji B, de la Houssaye G, Abitbol MM and Munier FL. TITLE Mutation in the human homeobox gene NKX5-3 causes an oculo-auricular syndrome JOURNAL Am J Hum Genet 82 (5), 1178-1184 (2008) PUBMED 18423520 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from EU050652.1. On Jan 17, 2008 this sequence version replaced XM_001334293.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: EU050652.1, EU203551.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2168447, SAMEA3505370 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..849 /organism="Danio rerio" /mol_type="mRNA" /strain="London AB" /db_xref="taxon:7955" /chromosome="1" /map="1" gene 1..849 /gene="hmx1" /gene_synonym="im:7155045; Nkx5-3; nkx5.3; zgc:172164" /note="H6 family homeobox 1" /db_xref="GeneID:797503" /db_xref="ZFIN:ZDB-GENE-080204-54" CDS 1..849 /gene="hmx1" /gene_synonym="im:7155045; Nkx5-3; nkx5.3; zgc:172164" /note="homeobox transcription factor SOHo; H6 homeo box 1" /codon_start=1 /product="homeobox protein HMX1" /protein_id="NP_001106998.1" /db_xref="GeneID:797503" /db_xref="ZFIN:ZDB-GENE-080204-54" /translation="
MHEKSQQQHTSTTSRGSSFFIENLLGSCRTEKPVCPIKDNDGTERANALKRYPNAYRKEMCVQASSAGFKTEISPLEWKGRETSRSPREESRNSSEYSRSDRDTPLASEPLDGVVDRKMSGCAVDEGDDARQLFDERSGPDTSEPGSARKKKTRTVFSRSQVFQLESTFDMKRYLSSSERAGLAASLHLTETQVKIWFQNRRNKWKRQLAADLEAVNFNHNSQRIVRVPILYHDKATPMSTLSFNVSQVSPPLMGFSNSVNYPLSSFAHSVNLMTSQMTGLV"
misc_feature order(451..465,469..471,520..522,538..540,577..579, 583..588,595..600,604..612,616..621) /gene="hmx1" /gene_synonym="im:7155045; Nkx5-3; nkx5.3; zgc:172164" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 457..618 /gene="hmx1" /gene_synonym="im:7155045; Nkx5-3; nkx5.3; zgc:172164" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(457..459,466..468,586..588,595..600,607..609) /gene="hmx1" /gene_synonym="im:7155045; Nkx5-3; nkx5.3; zgc:172164" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" exon 1..256 /gene="hmx1" /gene_synonym="im:7155045; Nkx5-3; nkx5.3; zgc:172164" /inference="alignment:Splign:2.1.0" exon 257..849 /gene="hmx1" /gene_synonym="im:7155045; Nkx5-3; nkx5.3; zgc:172164" /inference="alignment:Splign:2.1.0" ORIGIN
atgcatgaaaaaagccagcaacagcacacttccaccacatccaggggctcgtcgttttttatcgagaatttgcttggctcttgtaggacagaaaagcctgtctgtccaataaaggataacgatggcacggagagagcgaatgctctcaagcgctacccgaacgcatatcggaaagaaatgtgcgttcaagcgtccagcgcgggcttcaagacggagatctcgccgctggagtggaaaggacgcgaaacctccaggagtccaagagaggaaagccgcaattccagtgaatattcccgcagcgacagagacacccctttggcctctgagcctcttgatggagtagtggaccgaaaaatgagcggttgtgcggttgacgagggtgacgacgctcgacagctcttcgatgagcgttcggggccagacacttccgaacccggctcagcccgaaagaaaaagacccgaactgtgttcagcagaagccaggttttccagctagagtccacattcgacatgaagagatacctcagcagctctgagcgcgcggggctcgcggcctccctgcacctgaccgagacccaggtgaaaatctggtttcaaaaccgccgaaacaaatggaaaagacaactggccgcggatttagaggctgttaattttaaccacaactctcagcggattgtacgggtgccgatcttgtaccacgataaagctacacccatgtcgacactcagttttaacgtgtctcaagtctcgccaccattaatgggcttttcaaattcagtgaactatccattgtcgtcctttgctcattcagtgaatttaatgacatcgcagatgacaggccttgtctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]