GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-18 21:48:43, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_104576               2419 bp    mRNA    linear   PLN 20-OCT-2022
DEFINITION  Arabidopsis thaliana Zinc finger (C3HC4-type RING finger) family
            protein (VIM1), mRNA.
ACCESSION   NM_104576
VERSION     NM_104576.6
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 2419)
  AUTHORS   Theologis,A., Ecker,J.R., Palm,C.J., Federspiel,N.A., Kaul,S.,
            White,O., Alonso,J., Altafi,H., Araujo,R., Bowman,C.L.,
            Brooks,S.Y., Buehler,E., Chan,A., Chao,Q., Chen,H., Cheuk,R.F.,
            Chin,C.W., Chung,M.K., Conn,L., Conway,A.B., Conway,A.R.,
            Creasy,T.H., Dewar,K., Dunn,P., Etgu,P., Feldblyum,T.V., Feng,J.,
            Fong,B., Fujii,C.Y., Gill,J.E., Goldsmith,A.D., Haas,B.,
            Hansen,N.F., Hughes,B., Huizar,L., Hunter,J.L., Jenkins,J.,
            Johnson-Hopson,C., Khan,S., Khaykin,E., Kim,C.J., Koo,H.L.,
            Kremenetskaia,I., Kurtz,D.B., Kwan,A., Lam,B., Langin-Hooper,S.,
            Lee,A., Lee,J.M., Lenz,C.A., Li,J.H., Li,Y., Lin,X., Liu,S.X.,
            Liu,Z.A., Luros,J.S., Maiti,R., Marziali,A., Militscher,J.,
            Miranda,M., Nguyen,M., Nierman,W.C., Osborne,B.I., Pai,G.,
            Peterson,J., Pham,P.K., Rizzo,M., Rooney,T., Rowley,D., Sakano,H.,
            Salzberg,S.L., Schwartz,J.R., Shinn,P., Southwick,A.M., Sun,H.,
            Tallon,L.J., Tambunga,G., Toriumi,M.J., Town,C.D., Utterback,T.,
            Van Aken,S., Vaysberg,M., Vysotskaia,V.S., Walker,M., Wu,D., Yu,G.,
            Fraser,C.M., Venter,J.C. and Davis,R.W.
  TITLE     Sequence and analysis of chromosome 1 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 816-820 (2000)
   PUBMED   11130712
REFERENCE   2  (bases 1 to 2419)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (19-OCT-2022) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 2419)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-JUL-2017) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 2419)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   5  (bases 1 to 2419)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003070).
            
            On Sep 12, 2016 this sequence version replaced NM_104576.5.
FEATURES             Location/Qualifiers
     source          1..2419
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="1"
                     /ecotype="Columbia"
     gene            1..2419
                     /gene="VIM1"
                     /locus_tag="AT1G57820"
                     /gene_synonym="F12K22.14; F12K22_14; ORTH2; ORTHRUS 2;
                     VARIANT IN METHYLATION 1"
                     /note="Encodes a 645-amino acid methylcytosine-binding
                     protein with a PHD domain, two RING finger domains, and an
                     SRA domain that is involved in centromere
                     heterochromatinization. This protein functions as an E3
                     ubiquitin ligase in vitro. The protein has been shown to
                     bind to methylated cytosines of CG, CNG and CNN motifs via
                     its SRA domain but has a preference for the former. It
                     plays a role in the establishment/maintenance of chromatin
                     structure during cell division and is localized in the
                     nucleus. Plants over-expressing VIM1/ORTH2 show an
                     inhibition in root growth and a delay in flowering. Both
                     over-expression of GFP:ORTH2 and loss of ORTH2/VIM1 lead
                     to decreased levels of DNA methylation. GFP:ORTH2
                     over-expressers also have increased levels of FWA
                     transcripts."
                     /db_xref="Araport:AT1G57820"
                     /db_xref="GeneID:842157"
                     /db_xref="TAIR:AT1G57820"
     CDS             214..2151
                     /gene="VIM1"
                     /locus_tag="AT1G57820"
                     /gene_synonym="F12K22.14; F12K22_14; ORTH2; ORTHRUS 2;
                     VARIANT IN METHYLATION 1"
                     /codon_start=1
                     /product="Zinc finger (C3HC4-type RING finger) family
                     protein"
                     /protein_id="NP_176092.2"
                     /db_xref="Araport:AT1G57820"
                     /db_xref="GeneID:842157"
                     /db_xref="TAIR:AT1G57820"
                     /translation="
MARDIQLPCDGDGVCMRCKSNPPPEESLTCGTCVTPWHVSCLSSPPKTLASTLQWHCPDCSGEIDPLPVSGGATGFESAGSDLVAAIRAIEADESLSTEEKAKMRQRLLSGKGVEEDDEEEKRKKKGKGKNPNLDVLSALGDNLMCSFCMQLPERPVTKPCGHNACLKCFEKWMGQGKRTCGKCRSIIPEKMAKNPRINSSLVAAIRLAKVSKSAAATTSKVFHFISNQDRPDKAFTTERAKKTGKANAASGKIYVTIPPDHFGPIPAENDPVRNQGLLVGESWEDRLECRQWGAHFPHVAGIAGQSTYGAQSVALSGGYKDDEDHGEWFLYTGSGGRDLSGNKRTNKEQSFDQKFEKSNAALKLSCKLGYPVRVVRSHKEKRSAYAPEEGVRYDGVYRIEKCWRKVGVQGSFKVCRYLFVRCDNEPAPWTSDENGDRPRPIPNIPELNMATDLFERKETPSWDFDEGEGCWKWMKPPPASKKSVNVLAPEERKNLRKAIKAAHSNTMRARLLKEFKCQICQQVLTLPVTTPCAHNFCKACLEAKFAGKTLVRERSTGGRTLRSRKNVLNCPCCPTDISDFLQNPQVNREVAEVIEKLKTQEEDTAELEDEDEGECSGTTPEEDSEQPKKRIKLDTDATVSATIR"
     misc_feature    253..393
                     /gene="VIM1"
                     /locus_tag="AT1G57820"
                     /gene_synonym="F12K22.14; F12K22_14; ORTH2; ORTHRUS 2;
                     VARIANT IN METHYLATION 1"
                     /note="PHD zinc finger; Region: PHD; smart00249"
                     /db_xref="CDD:214584"
     misc_feature    order(292..303,313..315,376..378)
                     /gene="VIM1"
                     /locus_tag="AT1G57820"
                     /gene_synonym="F12K22.14; F12K22_14; ORTH2; ORTHRUS 2;
                     VARIANT IN METHYLATION 1"
                     /note="histone H3 binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:276966"
     misc_feature    637..780
                     /gene="VIM1"
                     /locus_tag="AT1G57820"
                     /gene_synonym="F12K22.14; F12K22_14; ORTH2; ORTHRUS 2;
                     VARIANT IN METHYLATION 1"
                     /note="first RING finger, HC subclass, found in
                     Arabidopsis thaliana ORTHRUS and similar proteins; Region:
                     RING-HC_ORTHRUS_rpt1; cd23138"
                     /db_xref="CDD:438500"
     misc_feature    997..1485
                     /gene="VIM1"
                     /locus_tag="AT1G57820"
                     /gene_synonym="F12K22.14; F12K22_14; ORTH2; ORTHRUS 2;
                     VARIANT IN METHYLATION 1"
                     /note="SAD/SRA domain; Region: SAD_SRA; pfam02182"
                     /db_xref="CDD:426640"
     misc_feature    1744..1959
                     /gene="VIM1"
                     /locus_tag="AT1G57820"
                     /gene_synonym="F12K22.14; F12K22_14; ORTH2; ORTHRUS 2;
                     VARIANT IN METHYLATION 1"
                     /note="second RING finger, HC subclass, found in
                     Arabidopsis thaliana ORTHRUS and similar proteins; Region:
                     RING-HC_ORTHRUS_rpt2; cd23139"
                     /db_xref="CDD:438501"
ORIGIN      
acaagacaacacatagccaaaaaaatcttttgggtatcgttttgaatttcaaagacgctctcgtcctttcccaaaatatttcaaacacccgcctcttcagtatttcgtttcccactctttttattcccaattctctagaaccttcctctctctccatctctcaaaatctcggaaacaccattttctcactctctgatcttttttcccccaaaaatggcgcgtgacatccaactcccctgcgacggcgacggcgtatgcatgcgatgcaaatccaaccctccgcctgaagaatctctcacttgcggcacgtgcgttacaccgtggcacgtgtcctgtctctcttcacctcccaaaaccctagcttccactctacagtggcattgtcctgattgctccggcgaaatcgatcctcttcctgtttccggcggtgctactggtttcgaatctgctgggtcagatcttgtagctgcgattcgtgcgattgaggctgatgagtcgttgagtactgaagagaaagctaagatgaggcaacggttactgagtggtaaaggtgttgaggaggatgatgaagaagagaagaggaagaagaaggggaaagggaagaatccgaatctggatgtgttatctgctcttggagataacttgatgtgttctttctgtatgcagttgcctgagagacctgtgacgaaaccatgtgggcacaacgcttgcttaaaatgttttgagaaatggatggggcagggaaagagaacttgtggtaaatgccgcagcataattcctgaaaaaatggctaagaatccccgtatcaactcgtctcttgttgctgccattcgattagcaaaagtctctaaaagtgctgctgcgaccacttcaaaggtctttcatttcatcagcaaccaagaccgaccagataaagcatttacaaccgagcgtgcaaagaaaactggcaaggcaaacgctgctagtggaaagatttatgttacaataccaccagatcattttggtcctattccagctgaaaatgaccctgtcaggaaccaaggtcttttggttggagaatcctgggaggacagactcgagtgtaggcagtggggtgctcatttcccacatgttgctggcattgctggacaatctacttatggcgctcaatctgtagcactctctggaggttataaggatgatgaggatcatggagaatggtttctatacacaggaagtgggggtagagatctcagtggcaacaaaaggactaacaaggagcagtcttttgaccaaaagtttgagaagtctaatgcagcattaaaactcagctgcaaattggggtatcctgttcgagttgtcaggtctcacaaggagaagcgttctgcatacgcccctgaggaaggagtgagatatgatggggtttacaggattgagaagtgctggcgcaaagttggagtacagggttcttttaaggtctgtcgttacctgttcgttagatgtgacaatgagccagctccatggaccagtgatgagaatggagatcgtccaagacctatccctaatattccagagcttaatatggccaccgacctgtttgagagaaaagaaactccatcatgggattttgatgaaggtgagggttgttggaaatggatgaagccgccacctgcaagtaaaaagtcagtgaatgttttggctcctgaggagaggaaaaatttgaggaaagccataaaggcggcacactcgaataccatgagggcaagacttctgaaagaatttaagtgccagatctgtcagcaagtgttgactcttcctgtgacaacaccctgtgctcataacttctgcaaggcttgcttagaagcgaaatttgctgggaaaactcttgtgagagagagaagcacaggtggacggacactacgctcaaggaagaatgtcctgaactgcccttgttgcccaacagacatatctgattttctgcagaaccctcaggtcaacagagaagtagcggaggtgatagagaagctaaagacccaggaagaggacaccgcagagcttgaagatgaagatgaaggtgaatgctcaggcaccacccctgaagaagattctgagcaaccgaagaaaaggatcaagttggacactgacgcaacagtttctgcgaccatcaggtgaagttggtaccaaagaactctttagtaaaaaaaaactctagtgccttattttgtacgcaatatttgtggaacgtacctattgcgatgtgttattttggatcttacaacaactaagttattaatatggaacgtaaactatggttctcaggttttcaatttttctcttattttggtgtctctggtttataactcggataggttggttttgataataccatcaggtactaagcagtgaattctcaatttagtatagaatggatgttgtttca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]