GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-01 21:37:34, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_876936                631 bp    RNA     linear   ROD 10-APR-2023
DEFINITION  PREDICTED: Mus musculus predicted gene, 41613 (Gm41613), transcript
            variant X1, ncRNA.
ACCESSION   XR_876936
VERSION     XR_876936.1
DBLINK      BioProject: PRJNA169
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000083.7) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_000001635.27-RS_2023_04
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 04/05/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..631
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6J"
                     /db_xref="taxon:10090"
                     /chromosome="17"
     gene            1..631
                     /gene="Gm41613"
                     /note="predicted gene, 41613; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 2 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:105246311"
                     /db_xref="MGI:MGI:5624498"
     ncRNA           1..631
                     /ncRNA_class="lncRNA"
                     /gene="Gm41613"
                     /product="predicted gene, 41613, transcript variant X1"
                     /db_xref="GeneID:105246311"
                     /db_xref="MGI:MGI:5624498"
ORIGIN      
cagctgctactgaccattgttgggagttgaacttcagactgaatagaaaccctgactaagacaacctgtgaaaacaaatcttgcttgagaagttacctccatcatattgcctttagtctctgcttgagttcctgcctcaagatcctgccctgcttgagttcctgttctggcttccaccatgatggattggaagctctaaggatccaccatggggagcaatggaacaggtcttcatctaaagagccggctgctaatctcccgcaaaaggtctctcagcattcccagtcatggtctccaccaagccaaggagcccacccgaacaagacaaggactctctcatccccacaggatccagccagagctcttctcccctgctttctccttaggccctgggcttgatccagcctgcgggttctcactccattctcagctcttctgcggcatccagtagaatctggaatgtccaggactctgagaacctgatgtcctcgcctccttgcagtcctggggaccccagagctggcccagttgtccctgaggatctcagactgcgctcccctgtggggagccgccctcacattctccgttgcaagatggcgctgacatcctgtgttctaagtggtaaacaaat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]