GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-20 01:50:36, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_671615                602 bp    RNA     linear   PLN 25-OCT-2016
DEFINITION  PREDICTED: Musa acuminata subsp. malaccensis uncharacterized
            LOC103984015 (LOC103984015), ncRNA.
ACCESSION   XR_671615
VERSION     XR_671615.2
DBLINK      BioProject: PRJNA262552
KEYWORDS    RefSeq.
SOURCE      Musa acuminata subsp. malaccensis (wild Malaysian banana)
  ORGANISM  Musa acuminata subsp. malaccensis
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Zingiberales; Musaceae;
            Musa.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_025206.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Oct 25, 2016 this sequence version replaced XR_671615.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Musa acuminata Annotation Release
                                           101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..602
                     /organism="Musa acuminata subsp. malaccensis"
                     /mol_type="transcribed RNA"
                     /sub_species="malaccensis"
                     /db_xref="taxon:214687"
                     /chromosome="5"
     gene            1..602
                     /gene="LOC103984015"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 7 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:103984015"
     ncRNA           1..602
                     /ncRNA_class="lncRNA"
                     /gene="LOC103984015"
                     /product="uncharacterized LOC103984015"
                     /db_xref="GeneID:103984015"
ORIGIN      
gtcaacagacaagtagtttgcaattcaaggtataggtgttgatgcccaagctactataccaatggatgtgtagaaaaatattgaatcctatgtcaaaataatgggctctcatggacaattatggtggaaagtgaagtctcctatattccaagcgcacgacgaaaacaaaaagatgttcaccaaaggtcaggaggtcacagagaagcaatcaatagatcaccaacctttcttttagatacaaaggcacctgtcatggcaacacctatcttttagatacaagctattggctattacatgagctcattggaaagggatggcacaactaccttctcagtcagccaaccatgatcgatgcaaatttatgaatgaagatggatcgtagaaaatcatccaaacggtgttcagctacgacgcatacaaatgttgcaagaacaaaatggcattggaatcggattgaatggtcaaacatgaaaactcacgagttcgcacagccttccaagtcaaaccctttaattgctgttagtgtgcacgattcccagtaacttgttgcgctgaaactacaaagagttgacctcaatgtcgagcataaaactaaaactgga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]