2024-05-01 08:33:57, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_385431 380 bp RNA linear ROD 10-APR-2023 DEFINITION PREDICTED: Mus musculus predicted gene, 35576 (Gm35576), ncRNA. ACCESSION XR_385431 VERSION XR_385431.2 DBLINK BioProject: PRJNA169 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_000083.7) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Sep 21, 2020 this sequence version replaced XR_385431.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_000001635.27-RS_2023_04 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; RefSeqFE; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 04/05/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..380 /organism="Mus musculus" /mol_type="transcribed RNA" /strain="C57BL/6J" /db_xref="taxon:10090" /chromosome="17" gene 1..380 /gene="Gm35576" /note="predicted gene, 35576; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 5 samples with support for all annotated introns" /db_xref="GeneID:102639216" /db_xref="MGI:MGI:5594735" ncRNA 1..380 /ncRNA_class="lncRNA" /gene="Gm35576" /product="predicted gene, 35576" /db_xref="GeneID:102639216" /db_xref="MGI:MGI:5594735" ORIGIN
gccaggagagccgcagcacccagccacccctggccttccatgtccttcctcagtgcaggaggattcccgaggtgttctttcaaaggcaggaccatggagcagtacaggaagtattctgctatggagtcagaatttagcttaagagttcacaggaaaaatgcacagtgtacaactttaagttacttgcttgtggaacagaagaacaaaaaagaattgccacagaattcagacttgtggagtgtaatcacccagagtaaggccagcctggaatccaaatcagctgcctcctgtatgctgtgtggaacatgccggctgaatcccaggctgttgcaagatctcctcttcccataatggggtacaaaggtagcccctttcaggta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]