2024-05-20 03:54:50, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_009721613 283 bp RNA linear INV 07-DEC-2023 DEFINITION PREDICTED: Saccostrea echinata uncharacterized LOC133190778 (LOC133190778), ncRNA. ACCESSION XR_009721613 VERSION XR_009721613.1 DBLINK BioProject: PRJNA1046542 KEYWORDS RefSeq. SOURCE Saccostrea echinata ORGANISM Saccostrea echinata Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Bivalvia; Autobranchia; Pteriomorphia; Ostreida; Ostreoidea; Ostreidae; Saccostrea. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_026889771) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_033153115.1-RS_2023_12 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 12/02/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..283 /organism="Saccostrea echinata" /mol_type="transcribed RNA" /isolate="AGI-Se365-2" /db_xref="taxon:191078" /chromosome="Unknown" /tissue_type="muscle" /ecotype="Australia" /country="Australia" /collection_date="2022" gene 1..283 /gene="LOC133190778" /note="uncharacterized LOC133190778; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:133190778" ncRNA 1..283 /ncRNA_class="lncRNA" /gene="LOC133190778" /product="uncharacterized LOC133190778" /db_xref="GeneID:133190778" ORIGIN
atgttgatgggtacgacaagttgaagccatttggcttcgctatacatggtgcaatgtgtggattttcaagacgaatactatggcttaaagttgcaagaacaaacaatgactcttttgttgtagcatcatatttcttgaaatacctggaggaaataaatagtgctccaaggtgtgtgagacttgatgctggaactgagaatatatacattgaggacattcaaaaatccttccgttggtacgataatgatgacatgtgtggagaaaaaagtgtaatcaaaggaag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]