GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-20 03:54:49, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_008432974             787 bp    RNA     linear   VRT 06-MAR-2023
DEFINITION  PREDICTED: Vidua chalybeata uncharacterized LOC128794063
            (LOC128794063), ncRNA.
ACCESSION   XR_008432974
VERSION     XR_008432974.1
DBLINK      BioProject: PRJNA940449
KEYWORDS    RefSeq.
SOURCE      Vidua chalybeata
  ORGANISM  Vidua chalybeata
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Passeroidea;
            Estrildidae; Viduinae; Vidua.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_071541) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_026979565.1-RS_2023_03
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 03/03/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..787
                     /organism="Vidua chalybeata"
                     /mol_type="transcribed RNA"
                     /isolate="OUT-0048"
                     /specimen_voucher="MSB:Bird:30254"
                     /db_xref="taxon:81927"
                     /chromosome="12"
                     /sex="female"
                     /tissue_type="muscle"
                     /country="South Africa"
                     /lat_lon="28.04 S 26.29 E"
                     /collection_date="2011-01-16"
     gene            1..787
                     /gene="LOC128794063"
                     /note="uncharacterized LOC128794063; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:128794063"
     ncRNA           1..787
                     /ncRNA_class="lncRNA"
                     /gene="LOC128794063"
                     /product="uncharacterized LOC128794063"
                     /db_xref="GeneID:128794063"
ORIGIN      
cccgtgcaagtacccagcattaagaatcgttctcttgcagaaaatgcacaacagggtttgttttccactatgtggtacttctgttaaagcacatcattaagctgaagcacttggactccatcttcaaagctggattgatggaaaacctgtaatgtcaacacctgggtaagtacagagagctagcaaaaaaaattcctagcagttctgaaacacttagcacaagaagatgtcatatgagctaaacaacaccctggtatcataactgcccagtgacactgctttcactgtgaatatgctctcacatcacctttagaaatgtgtcacctttattttcataaactttacatcaccttccagtttaacctcaggaaaggccactggtggtgctgatgattcagttgcaagaacaaaatagagatttcactgacctacatccgtcagccaaccatcctcaaggctatgttaccctctcataaaattggtgctgcatactcaccttccaatggaaaacaaagagctaccagcttcattagtcaatgttgctactgacaataaagtgtgctttgtgtactaagggtcggcactaaggacaagacaaacagaacaactactaaaaatgcctttcaaggctctttccctgtcactgtgaatgaaaactcttttgtctccaaggatactccacggtgggactgcacagcctgaatccagggagacggcctttccctgacaaagctaatcctgccaatcagaggagaattgctggcataagaagggcctggaagggcag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]