2024-05-20 03:54:49, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_008432974 787 bp RNA linear VRT 06-MAR-2023 DEFINITION PREDICTED: Vidua chalybeata uncharacterized LOC128794063 (LOC128794063), ncRNA. ACCESSION XR_008432974 VERSION XR_008432974.1 DBLINK BioProject: PRJNA940449 KEYWORDS RefSeq. SOURCE Vidua chalybeata ORGANISM Vidua chalybeata Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Passeriformes; Passeroidea; Estrildidae; Viduinae; Vidua. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_071541) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_026979565.1-RS_2023_03 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 03/03/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..787 /organism="Vidua chalybeata" /mol_type="transcribed RNA" /isolate="OUT-0048" /specimen_voucher="MSB:Bird:30254" /db_xref="taxon:81927" /chromosome="12" /sex="female" /tissue_type="muscle" /country="South Africa" /lat_lon="28.04 S 26.29 E" /collection_date="2011-01-16" gene 1..787 /gene="LOC128794063" /note="uncharacterized LOC128794063; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:128794063" ncRNA 1..787 /ncRNA_class="lncRNA" /gene="LOC128794063" /product="uncharacterized LOC128794063" /db_xref="GeneID:128794063" ORIGIN
cccgtgcaagtacccagcattaagaatcgttctcttgcagaaaatgcacaacagggtttgttttccactatgtggtacttctgttaaagcacatcattaagctgaagcacttggactccatcttcaaagctggattgatggaaaacctgtaatgtcaacacctgggtaagtacagagagctagcaaaaaaaattcctagcagttctgaaacacttagcacaagaagatgtcatatgagctaaacaacaccctggtatcataactgcccagtgacactgctttcactgtgaatatgctctcacatcacctttagaaatgtgtcacctttattttcataaactttacatcaccttccagtttaacctcaggaaaggccactggtggtgctgatgattcagttgcaagaacaaaatagagatttcactgacctacatccgtcagccaaccatcctcaaggctatgttaccctctcataaaattggtgctgcatactcaccttccaatggaaaacaaagagctaccagcttcattagtcaatgttgctactgacaataaagtgtgctttgtgtactaagggtcggcactaaggacaagacaaacagaacaactactaaaaatgcctttcaaggctctttccctgtcactgtgaatgaaaactcttttgtctccaaggatactccacggtgggactgcacagcctgaatccagggagacggcctttccctgacaaagctaatcctgccaatcagaggagaattgctggcataagaagggcctggaagggcag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]