LOCUS       XR_007263960             265 bp    RNA     linear   VRT 09-JUN-2022
DEFINITION  PREDICTED: Rhincodon typus uncharacterized LOC125485222
            (LOC125485222), ncRNA.
ACCESSION   XR_007263960
VERSION     XR_007263960.1
DBLINK      BioProject: PRJNA842712
KEYWORDS    RefSeq.
SOURCE      Rhincodon typus (whale shark)
  ORGANISM  Rhincodon typus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Chondrichthyes;
            Elasmobranchii; Galeomorphii; Galeoidea; Orectolobiformes;
            Rhincodontidae; Rhincodon.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_063348) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Rhincodon typus Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..265
                     /organism="Rhincodon typus"
                     /mol_type="transcribed RNA"
                     /isolate="14"
                     /db_xref="taxon:259920"
                     /chromosome="17"
                     /sex="male"
                     /tissue_type="blood"
                     /dev_stage="adult"
                     /collected_by="2018-05-24"
     gene            1..265
                     /gene="LOC125485222"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments"
                     /db_xref="GeneID:125485222"
     ncRNA           1..265
                     /ncRNA_class="lncRNA"
                     /gene="LOC125485222"
                     /product="uncharacterized LOC125485222"
                     /db_xref="GeneID:125485222"
ORIGIN      

tcggaggctggcagagcacgagaaggaggagaagagcaaggagtgtgagctgtggcatcagaaacacaatatccttaatgacatgctgaggagtcaagagaaggctgaaagaaaaaaataaagcttgtcaagccaaattccagacttacttgctgtgcaggacagaatgtgaccagcagctgtgttgcaagaacaaatgacaggactccgaagagttttgtggaaggagagcgagtgcactttactgaagctgatgcccaggtgc

//