2024-05-20 01:50:36, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_005992293 136 bp RNA linear VRT 26-MAY-2021 DEFINITION PREDICTED: Cheilinus undulatus small nucleolar RNA SNORA13 (LOC121514350), ncRNA. ACCESSION XR_005992293 VERSION XR_005992293.1 DBLINK BioProject: PRJNA731939 KEYWORDS RefSeq. SOURCE Cheilinus undulatus (humphead wrasse) ORGANISM Cheilinus undulatus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Eupercaria; Labriformes; Labridae; Cheilinus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_054872.1) annotated using gene prediction method: cmsearch. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Cheilinus undulatus Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.6 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..136 /organism="Cheilinus undulatus" /mol_type="transcribed RNA" /db_xref="taxon:241271" /sex="female" /tissue_type="muscle" /linkage_group="8" gene 1..136 /gene="LOC121514350" /note="Derived by automated computational analysis using gene prediction method: cmsearch." /db_xref="GeneID:121514350" ncRNA 1..136 /ncRNA_class="snoRNA" /gene="LOC121514350" /product="small nucleolar RNA SNORA13" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00396" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:121514350" /db_xref="RFAM:RF00396" ORIGIN
tgcctttatgtgttgccctttcatcatttccttggtgatcgggtgtcaaataaggcatacagggaaacttgtgactgccctttttgtttaaagagttttattcgactctattacacaaacagttgcaagaacaaat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]