GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-20 01:50:36, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_005992293             136 bp    RNA     linear   VRT 26-MAY-2021
DEFINITION  PREDICTED: Cheilinus undulatus small nucleolar RNA SNORA13
            (LOC121514350), ncRNA.
ACCESSION   XR_005992293
VERSION     XR_005992293.1
DBLINK      BioProject: PRJNA731939
KEYWORDS    RefSeq.
SOURCE      Cheilinus undulatus (humphead wrasse)
  ORGANISM  Cheilinus undulatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Labriformes; Labridae; Cheilinus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_054872.1) annotated using gene prediction method: cmsearch.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Cheilinus undulatus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..136
                     /organism="Cheilinus undulatus"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:241271"
                     /sex="female"
                     /tissue_type="muscle"
                     /linkage_group="8"
     gene            1..136
                     /gene="LOC121514350"
                     /note="Derived by automated computational analysis using
                     gene prediction method: cmsearch."
                     /db_xref="GeneID:121514350"
     ncRNA           1..136
                     /ncRNA_class="snoRNA"
                     /gene="LOC121514350"
                     /product="small nucleolar RNA SNORA13"
                     /inference="COORDINATES: nucleotide
                     motif:Rfam:12.0:RF00396"
                     /inference="COORDINATES: profile:INFERNAL:1.1.1"
                     /db_xref="GeneID:121514350"
                     /db_xref="RFAM:RF00396"
ORIGIN      
tgcctttatgtgttgccctttcatcatttccttggtgatcgggtgtcaaataaggcatacagggaaacttgtgactgccctttttgtttaaagagttttattcgactctattacacaaacagttgcaagaacaaat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]