2024-05-20 03:17:35, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_005960071 550 bp RNA linear INV 09-MAY-2021 DEFINITION PREDICTED: Gigantopelta aegis uncharacterized LOC121389490 (LOC121389490), ncRNA. ACCESSION XR_005960071 VERSION XR_005960071.1 DBLINK BioProject: PRJNA727593 KEYWORDS RefSeq. SOURCE Gigantopelta aegis ORGANISM Gigantopelta aegis Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Neomphalina; Neomphaloidea; Peltospiridae; Gigantopelta. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_054701.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Gigantopelta aegis Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.6 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..550 /organism="Gigantopelta aegis" /mol_type="transcribed RNA" /isolate="Gae_Host" /isolation_source="hydrothermal vent" /db_xref="taxon:1735272" /chromosome="3" /tissue_type="foot" /country="Indian Ocean" /collection_date="2019-04" gene 1..550 /gene="LOC121389490" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 3 samples with support for all annotated introns" /db_xref="GeneID:121389490" ncRNA 1..550 /ncRNA_class="lncRNA" /gene="LOC121389490" /product="uncharacterized LOC121389490" /db_xref="GeneID:121389490" ORIGIN
taggggaacccagagctgtgatgcacacggtgcacacggtgcacgggcagtgatacatggtgtgtggacacgtgtcacgttttggaactagagaggtttcctgtgaacagcttgggtcaggtgtattattgtgagctggggtgatgatgggttaccagcagcttgttgcgtcaccgtggggactgataccgatggcctcgttgatagtggaagagtgacggtcggatttattgagttggggtgataatggttaccagcagcttttggtgtcaccgttgaccgacactatagatggccttatttatggaacagagtgacggcgagtcgagggttgcaagaacaaagcaacactgtcgatgaacttgacctggacttggttacacgtatttgaaagggttctcaattccagagactgataatttattggtgcttggtgttattatatatgaacagtattaccttattaccagtgaattgtttataaaccaccactaaatattaagattaataattatttattgattcttggtgaaatacaaatgtaaaatta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]