GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-20 02:56:00, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_005958888             576 bp    RNA     linear   INV 09-MAY-2021
DEFINITION  PREDICTED: Gigantopelta aegis uncharacterized LOC121380153
            (LOC121380153), ncRNA.
ACCESSION   XR_005958888
VERSION     XR_005958888.1
DBLINK      BioProject: PRJNA727593
KEYWORDS    RefSeq.
SOURCE      Gigantopelta aegis
  ORGANISM  Gigantopelta aegis
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
            Neomphalina; Neomphaloidea; Peltospiridae; Gigantopelta.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_054706.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Gigantopelta aegis Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..576
                     /organism="Gigantopelta aegis"
                     /mol_type="transcribed RNA"
                     /isolate="Gae_Host"
                     /isolation_source="hydrothermal vent"
                     /db_xref="taxon:1735272"
                     /chromosome="8"
                     /tissue_type="foot"
                     /country="Indian Ocean"
                     /collection_date="2019-04"
     gene            1..576
                     /gene="LOC121380153"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 4 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:121380153"
     ncRNA           1..576
                     /ncRNA_class="lncRNA"
                     /gene="LOC121380153"
                     /product="uncharacterized LOC121380153"
                     /db_xref="GeneID:121380153"
ORIGIN      
cttggttaaaagtgctggtcagggctattgttaggggaacccagagctgtgatgcacacggttcacgggcagtgatacatggtgtgtggacacgtgtcacgttttggaactagagaggtttcctgtgaacagctggggtcaggtgtattattgtgagctggggtgatgatgggttaccagcagcttgttgcgtcaccgtggggactgataccgatggcctcgttgatagtggaagagtgacggtcggatttatagagttggggtgataatggttaccagcagcttctggtgtcaccgttgaccgacactatagatggccttatttatggaacagggtgacggcgagtcgagggttgcaagaacaaagcaacactgtcgatgaacttgacctggacttggttacatgtatttgaaaggggtctctattccagagactgataatttactggtgcttggtgcctggtgttattatatatgaacagtattaccttatttccagtgaattgtttataaaccaccactaaatattaagattaataattatttattgattcttggtgaaatacaaatgtaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]