2024-05-20 05:09:15, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_005185330 355 bp RNA linear INV 15-JUL-2022 DEFINITION PREDICTED: Rhipicephalus sanguineus uncharacterized LOC119400972 (LOC119400972), ncRNA. ACCESSION XR_005185330 VERSION XR_005185330.2 DBLINK BioProject: PRJNA674886 KEYWORDS RefSeq. SOURCE Rhipicephalus sanguineus (brown dog tick) ORGANISM Rhipicephalus sanguineus Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Chelicerata; Arachnida; Acari; Parasitiformes; Ixodida; Ixodoidea; Ixodidae; Rhipicephalinae; Rhipicephalus; Rhipicephalus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_051182.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Jul 15, 2022 this sequence version replaced XR_005185330.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: Rhipicephalus sanguineus Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..355 /organism="Rhipicephalus sanguineus" /mol_type="transcribed RNA" /isolate="Rsan-2018" /host="dog" /db_xref="taxon:34632" /chromosome="7" /tissue_type="Larvae" /country="China: Guangxi" /collection_date="10-Oct-2017" gene 1..355 /gene="LOC119400972" /note="uncharacterized LOC119400972; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:119400972" ncRNA 1..355 /ncRNA_class="lncRNA" /gene="LOC119400972" /product="uncharacterized LOC119400972" /experiment="COORDINATES: polyA evidence [ECO:0006239]" /db_xref="GeneID:119400972" ORIGIN
aagcctgcctcgctataagccagatcacgcctcgttattggtgcatgaaccatggcgaagacttcaagcttgcagcgaattgtcgttgtggctgcattagcctttcttctgtcgacgttgcaagaacaaagcagctttcgtgccactgcaagaaagacgccttgcaggaaccctaaatttctatgccccgaggaaatacggcgtcgtgaagaggagaggaggatgtgggtgtcttcgtacttatccggtccaaagcctcgggcagatccagacttgggtgcctagggaatttgcttgcagcaatggtgcaattctcaaatgagaacttctaaataaatctatcttgcttcaggaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]