GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-20 05:09:15, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_005185330             355 bp    RNA     linear   INV 15-JUL-2022
DEFINITION  PREDICTED: Rhipicephalus sanguineus uncharacterized LOC119400972
            (LOC119400972), ncRNA.
ACCESSION   XR_005185330
VERSION     XR_005185330.2
DBLINK      BioProject: PRJNA674886
KEYWORDS    RefSeq.
SOURCE      Rhipicephalus sanguineus (brown dog tick)
  ORGANISM  Rhipicephalus sanguineus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Chelicerata; Arachnida;
            Acari; Parasitiformes; Ixodida; Ixodoidea; Ixodidae;
            Rhipicephalinae; Rhipicephalus; Rhipicephalus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051182.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jul 15, 2022 this sequence version replaced XR_005185330.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: Rhipicephalus sanguineus Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..355
                     /organism="Rhipicephalus sanguineus"
                     /mol_type="transcribed RNA"
                     /isolate="Rsan-2018"
                     /host="dog"
                     /db_xref="taxon:34632"
                     /chromosome="7"
                     /tissue_type="Larvae"
                     /country="China: Guangxi"
                     /collection_date="10-Oct-2017"
     gene            1..355
                     /gene="LOC119400972"
                     /note="uncharacterized LOC119400972; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:119400972"
     ncRNA           1..355
                     /ncRNA_class="lncRNA"
                     /gene="LOC119400972"
                     /product="uncharacterized LOC119400972"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
                     /db_xref="GeneID:119400972"
ORIGIN      
aagcctgcctcgctataagccagatcacgcctcgttattggtgcatgaaccatggcgaagacttcaagcttgcagcgaattgtcgttgtggctgcattagcctttcttctgtcgacgttgcaagaacaaagcagctttcgtgccactgcaagaaagacgccttgcaggaaccctaaatttctatgccccgaggaaatacggcgtcgtgaagaggagaggaggatgtgggtgtcttcgtacttatccggtccaaagcctcgggcagatccagacttgggtgcctagggaatttgcttgcagcaatggtgcaattctcaaatgagaacttctaaataaatctatcttgcttcaggaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]