2024-05-20 02:37:39, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_004436991 713 bp RNA linear PRI 28-MAR-2020 DEFINITION PREDICTED: Trachypithecus francoisi uncharacterized LOC117083189 (LOC117083189), ncRNA. ACCESSION XR_004436991 VERSION XR_004436991.1 DBLINK BioProject: PRJNA614514 KEYWORDS RefSeq. SOURCE Trachypithecus francoisi (Francois's langur) ORGANISM Trachypithecus francoisi Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Cercopithecidae; Colobinae; Trachypithecus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_022681453.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Trachypithecus francoisi Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..713 /organism="Trachypithecus francoisi" /mol_type="transcribed RNA" /isolate="TF-2019V2" /db_xref="taxon:54180" /chromosome="Unknown" /sex="male" /tissue_type="muscle" gene 1..713 /gene="LOC117083189" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:117083189" ncRNA 1..713 /ncRNA_class="lncRNA" /gene="LOC117083189" /product="uncharacterized LOC117083189" /db_xref="GeneID:117083189" ORIGIN
agccatcctttcacgtttctgtcttagcaccaccagcactctgccactcactttttcttctctcctctgagcaagcgagctgcatgagtggagatgggttggaggaacctcttttcccaccctttcccaccagactaattgctttcaggaacctttggacctaatcgccagagctaaggagaaatgcttgactgcaagcaaaacaatgtgaaggttgcaagaacaaatttagtgttcgaaccaaatgagaacataagattgtgaggggcagatatgtaagacactgcaccaatgcctggatgtagcctcatggcctaagatggaaagttctcaattgccaactcctgtctgagtttgctctgccctggaatacctggcttgtattttcctcttattataaactttgatttatttatgaaaaagttttaaatgatctgatgccccacaaaatgttcaagttcatctatagattgtttcttgaagaagaaaacactaaatatgtgacttaaaatagtcagcagtagcttccagtttatcccaaattctgaaactacacagcgatttgagagattctagtactggaaaacacgccattcacccattaactgactgttgacaccaaggacatttggttcttggcccaactgtacctgcagaactagcaacacaaaaaatgttcaaaacattccctctcattctgtcttatattgaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]