2024-05-20 04:38:50, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_003706364 516 bp RNA linear VRT 21-APR-2019 DEFINITION PREDICTED: Podarcis muralis uncharacterized LOC114595849 (LOC114595849), ncRNA. ACCESSION XR_003706364 VERSION XR_003706364.1 DBLINK BioProject: PRJNA529705 KEYWORDS RefSeq. SOURCE Podarcis muralis (Common wall lizard) ORGANISM Podarcis muralis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata; Laterata; Lacertibaenia; Lacertidae; Podarcis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_041315.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Podarcis muralis Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..516 /organism="Podarcis muralis" /mol_type="transcribed RNA" /db_xref="taxon:64176" /chromosome="4" /sex="male" /tissue_type="muscle" /dev_stage="adult" /ecotype="yellow" gene 1..516 /gene="LOC114595849" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:114595849" ncRNA 1..516 /ncRNA_class="lncRNA" /gene="LOC114595849" /product="uncharacterized LOC114595849" /db_xref="GeneID:114595849" ORIGIN
tgcatgaaaagagaatcggatagggatggcaattgtgcttaatcttgaattgttttgcaggtagatgaaagaagatattgggagacatttaatgaataggaaaattaatcaaagtatgaataaataaagacattgaaaaatgattatatgtaatcacatgttattatgcagagccacctgctgaaacaaagacaggagacagggccttttttgtaaaggcgaaagatttatacgatctgaggataagccaaagtttttatcggtggttgcaagaacaaacgagccctatattccaaacaaagtgcttgattaacctggagggccggcttgaatggaataagcctcagagatgtacacaaaagcaagaatgagtggaggatcaatagaagcaaatcaggaaggcagaaaagctgagatttttaaagaagatggaacatgcagacagccccagtggaccaggccaacaacccatctagtcctgttctcacagcagccaatggcagaacctgcctcaca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]