2024-04-29 21:45:21, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_003351493 267 bp RNA linear PLN 02-OCT-2018 DEFINITION PREDICTED: Papaver somniferum uncharacterized LOC113332400 (LOC113332400), ncRNA. ACCESSION XR_003351493 VERSION XR_003351493.1 DBLINK BioProject: PRJNA492326 KEYWORDS RefSeq. SOURCE Papaver somniferum (opium poppy) ORGANISM Papaver somniferum Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Ranunculales; Papaveraceae; Papaveroideae; Papaver. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_039358.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Papaver somniferum Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..267 /organism="Papaver somniferum" /mol_type="transcribed RNA" /cultivar="HN1" /db_xref="taxon:3469" /chromosome="1" /tissue_type="leaves" /dev_stage="seedling" /country="Australia" gene 1..267 /gene="LOC113332400" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 9 samples with support for all annotated introns" /db_xref="GeneID:113332400" ncRNA 1..267 /ncRNA_class="lncRNA" /gene="LOC113332400" /product="uncharacterized LOC113332400" /db_xref="GeneID:113332400" ORIGIN
gaagaagctggcagcactgaaaccagagaatagcactgtcaatgagtgggaagagttcgtgaaacatgtttgctcggaggaattcagaacaaaaagattctggatgcaacaaatcaggaagaaatacaccactccacacactatcagtagactgggttgggtgagactcgaggctaagatgcaaaaggaacggaaaacacaagaagagattgatagagtcgaagtttggacaacgggtcacaaacataaggaaggaaaggaacctaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]