LOCUS       XR_002720009             287 bp    RNA     linear   PLN 29-NOV-2017
DEFINITION  PREDICTED: Cucurbita maxima uncharacterized LOC111493425
            (LOC111493425), ncRNA.
ACCESSION   XR_002720009
VERSION     XR_002720009.1
DBLINK      BioProject: PRJNA418295
KEYWORDS    RefSeq.
SOURCE      Cucurbita maxima (winter squash)
  ORGANISM  Cucurbita maxima
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; fabids; Cucurbitales; Cucurbitaceae;
            Cucurbiteae; Cucurbita.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_019272034.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Cucurbita maxima Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..287
                     /organism="Cucurbita maxima"
                     /mol_type="transcribed RNA"
                     /cultivar="Rimu"
                     /db_xref="taxon:3661"
                     /chromosome="Unknown"
                     /tissue_type="Young leaves"
                     /dev_stage="Seedlings"
                     /country="China: Beijing"
     gene            1..287
                     /gene="LOC111493425"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 33 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:111493425"
     ncRNA           1..287
                     /ncRNA_class="lncRNA"
                     /gene="LOC111493425"
                     /product="uncharacterized LOC111493425"
                     /db_xref="GeneID:111493425"
ORIGIN      

aactcatataaagcaatacaaacactcgttccttcaccaacacaaacattcactctcaaaggcatgcttcaaaatactgagaggatgaagatgagacgtgtagcggttggcgtagtgatggtgtttatgattatcaacactttgtttgttgctgatggaaggcacttgaagttgcaagaacaaagggatgagaaccaaaacttggaagccaaaaagcactatgaaactaatgaatacaatcaccatggatgctatagaagtgactataattgttggagcaacagaaa

//