LOCUS       XR_002067745             436 bp    RNA     linear   PLN 05-DEC-2016
DEFINITION  PREDICTED: Nicotiana attenuata uncharacterized LOC109224637
            (LOC109224637), ncRNA.
ACCESSION   XR_002067745
VERSION     XR_002067745.1
DBLINK      BioProject: PRJNA355166
KEYWORDS    RefSeq.
SOURCE      Nicotiana attenuata
  ORGANISM  Nicotiana attenuata
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; asterids; lamiids; Solanales; Solanaceae;
            Nicotianoideae; Nicotianeae; Nicotiana.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_031991.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Nicotiana attenuata Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..436
                     /organism="Nicotiana attenuata"
                     /mol_type="transcribed RNA"
                     /strain="UT"
                     /db_xref="taxon:49451"
                     /chromosome="3"
                     /tissue_type="leaves"
                     /dev_stage="rosette stage"
                     /country="USA: Washington County, Utah"
                     /genotype="Utah 30x inbred"
     gene            1..436
                     /gene="LOC109224637"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 18 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:109224637"
     ncRNA           1..436
                     /ncRNA_class="lncRNA"
                     /gene="LOC109224637"
                     /product="uncharacterized LOC109224637"
                     /db_xref="GeneID:109224637"
ORIGIN      

aacctaaacttctaccccattcctcagccgccactcttctctccgttttattactcctttcttccacaatagcgttaatttaaagttgcaagaacaaagaggagtaagaggggtgctcaagaaagcaatgcctttgagaaatttcaatctcttctaatgccaaatatatagtgattacggagagtgcttcattattcttggatgcatgaagatcaagcgcgacgagggtggcgacatgaatcatcaagcaaatacttatgttcatttaatatgaaattttgtactttattttttatctctattacaatcaagcctcacatttgctagttattttcttcaagttatagttattgtagaagacttctctactgcatatgctattaattcattagtactggattttggaatttattttatgaatttttttaaatgccaa

//