2024-05-20 04:08:29, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_002065752 425 bp RNA linear PLN 05-DEC-2016 DEFINITION PREDICTED: Nicotiana attenuata uncharacterized LOC109211627 (LOC109211627), ncRNA. ACCESSION XR_002065752 VERSION XR_002065752.1 DBLINK BioProject: PRJNA355166 KEYWORDS RefSeq. SOURCE Nicotiana attenuata ORGANISM Nicotiana attenuata Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; asterids; lamiids; Solanales; Solanaceae; Nicotianoideae; Nicotianeae; Nicotiana. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_017672065.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Nicotiana attenuata Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..425 /organism="Nicotiana attenuata" /mol_type="transcribed RNA" /strain="UT" /db_xref="taxon:49451" /chromosome="Unknown" /tissue_type="leaves" /dev_stage="rosette stage" /country="USA: Washington County, Utah" /genotype="Utah 30x inbred" gene 1..425 /gene="LOC109211627" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 19 samples with support for all annotated introns" /db_xref="GeneID:109211627" ncRNA 1..425 /ncRNA_class="lncRNA" /gene="LOC109211627" /product="uncharacterized LOC109211627" /db_xref="GeneID:109211627" ORIGIN
atcaaacctaaacttctaccccacccctcagccgccactctcctctccgttttattactcctttcttccacaatagcgttaatttaaagttgcaagaacaaagaggagtaagaggggtgctcaagaaagcaatgcctttgagaaatttcaatctcttctaatgccaaatatatagtgattacggagagtgcttcattattcttggatgcatgaagatcaagtgcgacgagggcggcgacatgaatcatcaagcaaatacttatgttcatttaatatgaaattttgtactttattttttatctctattacaatcaagcctcacattttctagttattttcttcaagttttagttaccgtagaagacttctctactgcatatgctattaatttattagtacaaatgtggattttggaatttatttta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]