2024-05-18 18:22:13, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_059826172 3948 bp mRNA linear VRT 29-SEP-2023 DEFINITION PREDICTED: Gavia stellata ATPase copper transporting beta (ATP7B), mRNA. ACCESSION XM_059826172 VERSION XM_059826172.1 DBLINK BioProject: PRJNA1021185 KEYWORDS RefSeq; includes ab initio. SOURCE Gavia stellata (red-throated loon) ORGANISM Gavia stellata Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Gaviiformes; Gaviidae; Gavia. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_082594) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_030936135.1-RS_2023_09 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 09/26/2023 ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 3% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..3948 /organism="Gavia stellata" /mol_type="mRNA" /isolate="bGavSte3" /db_xref="taxon:37040" /chromosome="1" /sex="male" /tissue_type="muscle" /dev_stage="adult" /country="Greenland" /lat_lon="71.7069 N 42.6043 W" /collection_date="2019-08-01" /collected_by="Mikkel Sinding" gene 1..3948 /gene="ATP7B" /note="ATPase copper transporting beta; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 17 Proteins" /db_xref="GeneID:104262404" CDS 4..3948 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2" /protein_id="XP_059682155.1" /db_xref="GeneID:104262404" /translation="
MKHSFAFDNMGYEESFETMPSPSSQEHTVAVNIVGMTCQSCVQSIEGRISKVKGIVSIKVSLEQNNAVIKYLQSEISPEQICQEIQDMGFDANITEEKLTTATINLSCLREAVVKLRVEGMTCQSCVTNIEGKIRKLHGVVKIKVSLGNQEAIIAYYPYIIQPDDLKSHISNLGYDCTIKSKPALLKLGVLDLGRLQNANPKETPASPESDKVDPLVAEMSGTATVDIQIEGMHCKSWTISQRQGVQCIAVSLADRTGTIHYDPAVTNGGELRAAIEDMGFDASVLTDTATGECRHQPDTSNAAVQPRAPETPHQGCASDALPDSPHLDGPNQPSGVTAEKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPEFIQPLEIAQLIQNLGFEATVIEDHAETEGNVELLITGMTCASCVHNIESKLMRTNGIFYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVARRVPNAHNLDHKKEIQQWRKSFLCSLLFGIPVLILMIYMLIPDGEHHGSMVLEQNLIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKTANMDVLIVLATTIAYVYSCVILMVAIIEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPDHSIVREEQVAVELVQRGDIIKVVPGGKFPVDGKVIEGSSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINFDVIQKYFPNQNKQVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLPLKKVLVVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTNFQAVPGCGISCKVGGVEAVLGMAEEGLDKLDANRSGDSSAPLAGPSASHTYSVLIGNREWMRRNGLHIANDVNDAMTDHETKGQTAILVAIDGVLCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRRKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDTESYEVQAQGRMKPLTPSQISVHIGMDDRRRDSSRPTPWDQISQVSLSSLTSDKLPRCNGFVEEEGDKWSLLMNGGDEEQYI"
ORIGIN
acaatgaaacacagttttgcttttgacaacatgggctatgaggagagctttgaaaccatgccctctccatcttcccaagagcacactgtggcagtcaacattgtgggaatgacttgccaatcttgtgtgcagtcaatagaaggccgaatttccaaggtgaagggcattgtgagtattaaagtctcccttgaacagaacaatgctgtaataaagtatctgcaatcggaaataagtcctgaacagatttgccaggaaattcaggatatgggatttgacgccaacataacagaagagaagttgacaacagcgaccataaatttgtcgtgcttgagagaagcagtagttaagcttcgggtagaaggcatgacatgccagtcctgtgtcaccaacattgaaggaaagattaggaaactgcatggtgtggtgaaaatcaaggtgtcgcttggtaaccaggaagcaattattgcttactatccttacatcattcagcctgatgacctcaagagccatatcagtaacctggggtatgactgcaccattaaaagtaaaccagcccttttaaagctgggtgtccttgatctcgggcgcctgcagaatgcaaaccccaaggagacaccagcaagtcctgagagtgacaaggtggatccactggtcgccgagatgagtggcacagctacggtggatatacagatagaaggcatgcactgcaagtcctggaccatatcacagagacaaggagtgcaatgtatagcagtttctctagctgacagaactgggaccatacattatgatccagctgtcactaatggaggagagttaagagctgccatagaagacatggggtttgatgcttcggtgctgacagataccgccactggagaatgtaggcaccagcctgacaccagcaatgctgccgtgcagcctcgagctccagagactcctcaccaaggctgtgcctcggatgctcttccggacagtcctcaccttgatgggccaaaccagcccagcggagtgacagctgaaaagtgttttttacaaatcacgggcatgacctgtgcatcatgtgtgtccaccattgaaagaaatttgcagaaagaagacggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaattcatacagcctcttgaaatagcacagctgatccagaatttgggttttgaagctaccgtcatagaagatcatgcagaaacagaaggcaatgtggaacttcttattacagggatgacttgtgcttcttgcgttcacaatattgaatccaaactcatgagaacaaatggcatattctacgcctcagttgcacttgctacttgcaaagctcacatccagtttgatcctgaaattactggacctcgagatattataaaaataattgaggaaattggctttcatgcttctgtggctagaagagttccaaatgcacataacctggatcataaaaaggaaatacagcagtggaggaaatctttcttgtgcagcctactgtttggtatccctgtcttaatactaatgatttatatgctaatacccgacggtgagcaccatgggtctatggtgctggaacagaacctcattcctggattatctattttaaatcttctcttctttgtcctgtgcacttttgttcagtttcttggtggatggtatttttatgtacaagcttacaaatcactgaagcacaagacagccaatatggatgtgctcatcgtactggccacgaccattgcttatgtgtattcgtgtgtgatcctgatggtagcgataattgaaaaggcagaaaaaagccctgtcactttctttgacactcctccgatgctgtttgtgttcattgcccttgggagatggctggaacacatagcaaagagtaagacctcagaagctcttgctaaacttatatctcttcaagccacagaagccactgtggtgactcttggacctgaccactctattgtcagggaggagcaggtagcggttgaactggttcaaaggggtgatataataaaggttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcagttctatggcagacgagtctctcattactggggaagctatgccagtcactaaaaagcctgggagcacagtgattgctggttcaataaatgcacatggctcagttcttgttaatgcaactcatgttggtaatgataccactctggcacaaatcgtgaaattggtggaagaagctcaaatgtcaaaggcacccatccagcaattggcagataagtttagtggatattttgttccatttatcatcatcatttcaacagtgacgttgatagtatggatcacaattggttttataaattttgatgttattcaaaagtattttcctaatcagaacaaacaggtttcaaaagctgaactaatactgaggtttgcgtttcaaacctcaatcactgtgctgagcattgcatgcccatgttctttaggcttggctactcccacagctgtgatggtgggcacaggagttgctgcacagaatggtattctcatcaaaggcggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataaaactgggaccatcacctgcggagttcctaaagtcatgagggtgcttttgctgggagacacagctgtgctccctctgaagaaggtactggtggtggttggcactgcagaagccagcagcgagcatcctttaggagtggcagtgactaaatattgcaaagaggagcttggcactcagagcctgggatactgcaccaacttccaggcagtcccgggctgtggcatcagctgcaaagtcggaggtgttgaggctgtcctgggcatggctgaggagggtctcgataagctggacgctaacaggagcggggacagcagtgctcctctggcaggtccatcagcttctcatacatactcggtgttgattggaaatcgtgagtggatgcgacgcaatggcttgcatattgcaaatgatgtaaatgatgcaatgacagaccatgaaacgaaaggacagactgccatactagtggctatagatggagtgttgtgtggaatgattgcaatagcagacactgtcaagcaggaggcagcccttgctgtgcacacgctgaaaaacatgggaatagatgtggtgctgataacgggggacaacagaaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcacaaggttgcaaaggtccaggagctccaaaatgggagaaggaaggttgcgatggttggtgatggagtcaatgattcccctgcactagccagggccgatgttggaattgcaattggaacgggcactgatgttgccattgaagcagcagatgttgttcttatccgaaacgatttgctggatgtagttgccagtattcacttatcaaagagaacagtccgaagaatacgaataaatctgattcttgccttaatttataatctgcttggaatacccatagcagcaggtgtattcatgcctgttggccttgtgcttcagccttggatgggatcagctgcaatggcagcttcttctgtgtctgttgtgctgtcttccctgcagctgaaatgttataagaagccagacacagaaagttatgaagtacaagctcaaggccgcatgaagccacttactccttcccaaatcagtgttcatattggaatggatgataggaggagggattcatccagaccaactccttgggatcagattagccaagtgtccctctcttccttgacttcagacaagctgccgagatgtaatggttttgttgaggaggaaggggacaagtggtcattgctcatgaatggaggagatgaagaacagtacatctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]