GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-18 18:22:13, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_059826172            3948 bp    mRNA    linear   VRT 29-SEP-2023
DEFINITION  PREDICTED: Gavia stellata ATPase copper transporting beta (ATP7B),
            mRNA.
ACCESSION   XM_059826172
VERSION     XM_059826172.1
DBLINK      BioProject: PRJNA1021185
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Gavia stellata (red-throated loon)
  ORGANISM  Gavia stellata
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Gaviiformes; Gaviidae; Gavia.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_082594) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_030936135.1-RS_2023_09
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 09/26/2023
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 3% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..3948
                     /organism="Gavia stellata"
                     /mol_type="mRNA"
                     /isolate="bGavSte3"
                     /db_xref="taxon:37040"
                     /chromosome="1"
                     /sex="male"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /country="Greenland"
                     /lat_lon="71.7069 N 42.6043 W"
                     /collection_date="2019-08-01"
                     /collected_by="Mikkel Sinding"
     gene            1..3948
                     /gene="ATP7B"
                     /note="ATPase copper transporting beta; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 17 Proteins"
                     /db_xref="GeneID:104262404"
     CDS             4..3948
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2"
                     /protein_id="XP_059682155.1"
                     /db_xref="GeneID:104262404"
                     /translation="
MKHSFAFDNMGYEESFETMPSPSSQEHTVAVNIVGMTCQSCVQSIEGRISKVKGIVSIKVSLEQNNAVIKYLQSEISPEQICQEIQDMGFDANITEEKLTTATINLSCLREAVVKLRVEGMTCQSCVTNIEGKIRKLHGVVKIKVSLGNQEAIIAYYPYIIQPDDLKSHISNLGYDCTIKSKPALLKLGVLDLGRLQNANPKETPASPESDKVDPLVAEMSGTATVDIQIEGMHCKSWTISQRQGVQCIAVSLADRTGTIHYDPAVTNGGELRAAIEDMGFDASVLTDTATGECRHQPDTSNAAVQPRAPETPHQGCASDALPDSPHLDGPNQPSGVTAEKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPEFIQPLEIAQLIQNLGFEATVIEDHAETEGNVELLITGMTCASCVHNIESKLMRTNGIFYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVARRVPNAHNLDHKKEIQQWRKSFLCSLLFGIPVLILMIYMLIPDGEHHGSMVLEQNLIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKTANMDVLIVLATTIAYVYSCVILMVAIIEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPDHSIVREEQVAVELVQRGDIIKVVPGGKFPVDGKVIEGSSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINFDVIQKYFPNQNKQVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLPLKKVLVVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTNFQAVPGCGISCKVGGVEAVLGMAEEGLDKLDANRSGDSSAPLAGPSASHTYSVLIGNREWMRRNGLHIANDVNDAMTDHETKGQTAILVAIDGVLCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRRKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDTESYEVQAQGRMKPLTPSQISVHIGMDDRRRDSSRPTPWDQISQVSLSSLTSDKLPRCNGFVEEEGDKWSLLMNGGDEEQYI"
ORIGIN      
acaatgaaacacagttttgcttttgacaacatgggctatgaggagagctttgaaaccatgccctctccatcttcccaagagcacactgtggcagtcaacattgtgggaatgacttgccaatcttgtgtgcagtcaatagaaggccgaatttccaaggtgaagggcattgtgagtattaaagtctcccttgaacagaacaatgctgtaataaagtatctgcaatcggaaataagtcctgaacagatttgccaggaaattcaggatatgggatttgacgccaacataacagaagagaagttgacaacagcgaccataaatttgtcgtgcttgagagaagcagtagttaagcttcgggtagaaggcatgacatgccagtcctgtgtcaccaacattgaaggaaagattaggaaactgcatggtgtggtgaaaatcaaggtgtcgcttggtaaccaggaagcaattattgcttactatccttacatcattcagcctgatgacctcaagagccatatcagtaacctggggtatgactgcaccattaaaagtaaaccagcccttttaaagctgggtgtccttgatctcgggcgcctgcagaatgcaaaccccaaggagacaccagcaagtcctgagagtgacaaggtggatccactggtcgccgagatgagtggcacagctacggtggatatacagatagaaggcatgcactgcaagtcctggaccatatcacagagacaaggagtgcaatgtatagcagtttctctagctgacagaactgggaccatacattatgatccagctgtcactaatggaggagagttaagagctgccatagaagacatggggtttgatgcttcggtgctgacagataccgccactggagaatgtaggcaccagcctgacaccagcaatgctgccgtgcagcctcgagctccagagactcctcaccaaggctgtgcctcggatgctcttccggacagtcctcaccttgatgggccaaaccagcccagcggagtgacagctgaaaagtgttttttacaaatcacgggcatgacctgtgcatcatgtgtgtccaccattgaaagaaatttgcagaaagaagacggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaattcatacagcctcttgaaatagcacagctgatccagaatttgggttttgaagctaccgtcatagaagatcatgcagaaacagaaggcaatgtggaacttcttattacagggatgacttgtgcttcttgcgttcacaatattgaatccaaactcatgagaacaaatggcatattctacgcctcagttgcacttgctacttgcaaagctcacatccagtttgatcctgaaattactggacctcgagatattataaaaataattgaggaaattggctttcatgcttctgtggctagaagagttccaaatgcacataacctggatcataaaaaggaaatacagcagtggaggaaatctttcttgtgcagcctactgtttggtatccctgtcttaatactaatgatttatatgctaatacccgacggtgagcaccatgggtctatggtgctggaacagaacctcattcctggattatctattttaaatcttctcttctttgtcctgtgcacttttgttcagtttcttggtggatggtatttttatgtacaagcttacaaatcactgaagcacaagacagccaatatggatgtgctcatcgtactggccacgaccattgcttatgtgtattcgtgtgtgatcctgatggtagcgataattgaaaaggcagaaaaaagccctgtcactttctttgacactcctccgatgctgtttgtgttcattgcccttgggagatggctggaacacatagcaaagagtaagacctcagaagctcttgctaaacttatatctcttcaagccacagaagccactgtggtgactcttggacctgaccactctattgtcagggaggagcaggtagcggttgaactggttcaaaggggtgatataataaaggttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcagttctatggcagacgagtctctcattactggggaagctatgccagtcactaaaaagcctgggagcacagtgattgctggttcaataaatgcacatggctcagttcttgttaatgcaactcatgttggtaatgataccactctggcacaaatcgtgaaattggtggaagaagctcaaatgtcaaaggcacccatccagcaattggcagataagtttagtggatattttgttccatttatcatcatcatttcaacagtgacgttgatagtatggatcacaattggttttataaattttgatgttattcaaaagtattttcctaatcagaacaaacaggtttcaaaagctgaactaatactgaggtttgcgtttcaaacctcaatcactgtgctgagcattgcatgcccatgttctttaggcttggctactcccacagctgtgatggtgggcacaggagttgctgcacagaatggtattctcatcaaaggcggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataaaactgggaccatcacctgcggagttcctaaagtcatgagggtgcttttgctgggagacacagctgtgctccctctgaagaaggtactggtggtggttggcactgcagaagccagcagcgagcatcctttaggagtggcagtgactaaatattgcaaagaggagcttggcactcagagcctgggatactgcaccaacttccaggcagtcccgggctgtggcatcagctgcaaagtcggaggtgttgaggctgtcctgggcatggctgaggagggtctcgataagctggacgctaacaggagcggggacagcagtgctcctctggcaggtccatcagcttctcatacatactcggtgttgattggaaatcgtgagtggatgcgacgcaatggcttgcatattgcaaatgatgtaaatgatgcaatgacagaccatgaaacgaaaggacagactgccatactagtggctatagatggagtgttgtgtggaatgattgcaatagcagacactgtcaagcaggaggcagcccttgctgtgcacacgctgaaaaacatgggaatagatgtggtgctgataacgggggacaacagaaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcacaaggttgcaaaggtccaggagctccaaaatgggagaaggaaggttgcgatggttggtgatggagtcaatgattcccctgcactagccagggccgatgttggaattgcaattggaacgggcactgatgttgccattgaagcagcagatgttgttcttatccgaaacgatttgctggatgtagttgccagtattcacttatcaaagagaacagtccgaagaatacgaataaatctgattcttgccttaatttataatctgcttggaatacccatagcagcaggtgtattcatgcctgttggccttgtgcttcagccttggatgggatcagctgcaatggcagcttcttctgtgtctgttgtgctgtcttccctgcagctgaaatgttataagaagccagacacagaaagttatgaagtacaagctcaaggccgcatgaagccacttactccttcccaaatcagtgttcatattggaatggatgataggaggagggattcatccagaccaactccttgggatcagattagccaagtgtccctctcttccttgacttcagacaagctgccgagatgtaatggttttgttgaggaggaaggggacaagtggtcattgctcatgaatggaggagatgaagaacagtacatctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]