GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-19 12:31:11, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_058859894            1163 bp    mRNA    linear   VRT 14-AUG-2023
DEFINITION  PREDICTED: Poecile atricapillus biliverdin reductase B (BLVRB),
            mRNA.
ACCESSION   XM_058859894
VERSION     XM_058859894.1
DBLINK      BioProject: PRJNA1004590
KEYWORDS    RefSeq.
SOURCE      Poecile atricapillus (Black-capped chickadee)
  ORGANISM  Poecile atricapillus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Paridae; Poecile.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_081279) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_030490865.1-RS_2023_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/11/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1163
                     /organism="Poecile atricapillus"
                     /mol_type="mRNA"
                     /isolate="bPoeAtr1"
                     /db_xref="taxon:48891"
                     /chromosome="31"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
                     /country="USA: Rockefeller University Field Research
                     Center, Millbrook, New York"
                     /lat_lon="41.767983 N 73.750862 W"
                     /collection_date="2018-05-18"
                     /collected_by="Jean-Nicolas Audet"
     gene            1..1163
                     /gene="BLVRB"
                     /note="biliverdin reductase B; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 9
                     Proteins"
                     /db_xref="GeneID:131590052"
     CDS             16..1095
                     /gene="BLVRB"
                     /codon_start=1
                     /product="flavin reductase (NADPH)"
                     /protein_id="XP_058715877.1"
                     /db_xref="GeneID:131590052"
                     /translation="
MKTGIGIKPGPESNRDRDKTGTGTKPGLGSNRDRDWDKTGTGIKPGPGQNRDRNKTGIGISWIGISWIWIPRSGAAAPERCEPRRSRPARGSLPVPPSPSQFPPSPSQFPPSPARGRGQNSPVRSRSRFRSRFDPDPGPGSVRSRFGVRRMKKIAIFGATGRTGRVTLGLALEQGLEVTVLVRDPSRLPPGPSPTRLLQGDARDPRAVGEALRGQEGVLILLGTGTDLSPTTVMSDATKTIVEAMAEHGVPKVVVCLSAFLLWEPERVPERLRPLTEDHSRMERILRHSGLRCVYVMPPHIAVEQPLTGDYEVSVGVAGGPGSSRQISALDLGHFMLRCLRSDEFDGKSVYVSRHYPKE"
     misc_feature    472..1071
                     /gene="BLVRB"
                     /note="biliverdin IX beta reductase (BVR-B, aka flavin
                     reductase)-like proteins; atypical (a) SDRs; Region:
                     BVR-B_like_SDR_a; cd05244"
                     /db_xref="CDD:187555"
     misc_feature    order(487..489,493..504,562..564,574..576,619..621,
                     676..684,712..717,781..789,850..852,907..915)
                     /gene="BLVRB"
                     /note="NAD binding site [chemical binding]; other site"
                     /db_xref="CDD:187555"
     misc_feature    order(688..693,787..795,802..804,829..831,838..843,
                     850..852,907..915,988..990)
                     /gene="BLVRB"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:187555"
     misc_feature    order(715..717,787..789,838..840,850..852)
                     /gene="BLVRB"
                     /note="putative active site [active]"
                     /db_xref="CDD:187555"
ORIGIN      
aaaaccgggaccgggatgaaaaccgggattgggataaaaccaggaccggaatcaaaccgggaccgggacaaaaccgggaccggaacaaaaccgggactaggatcaaaccgggatcgggactgggataaaaccgggaccggaatcaaaccgggaccgggacaaaaccgggaccggaacaaaaccgggatcgggatctcatggatcgggatctcatggatttggatcccgcggtccggggcggctgcaccggaacgatgcgaaccgaggcggtcccgccccgcccgggggtccctcccagtccctcccagtccctcccagttccctcccagtccctcccagttccctcccagtcccgcccgggggcgcggccaaaactccccggttcgatcccggtcccggttccggtcccggttcgaccccgatcccggtcccggttcggtccggtcccggttcggggtgaggaggatgaagaagatcgcgattttcggggccaccggcagaaccgggcgggtcacgctggggctggcgctggagcaggggctggaggtgaccgtcctggtccgggacccctcgcggctgccccccggcccctcccccacgcggctgctgcagggggacgcgcgggacccccgggcggtgggggaggccctgaggggccaggagggggtcctgatcctgctgggcaccggaaccgacctcagccccaccacggtcatgtccgacgccaccaaaaccatcgtggaggccatggctgagcacggcgtgcccaaggtggtggtgtgtctgtccgcgttcctgctgtgggagcccgagcgcgttcccgagcggctgcggccgctgaccgaggatcattcccgcatggagcggatcctgcggcactcggggctgcgctgcgtctacgtcatgcccccgcacatcgccgtggagcagccgctcaccggggattacgaggtctcggtgggcgtggcgggcgggccgggatcctcccggcagatctcggcgctggatctcggacacttcatgctccgctgcctccggagcgacgagttcgacgggaagagcgtctacgtcagccgccactaccccaaggagtagggatccacttccgccaggatccgccaccgggatccacccccgggatccgcccccgggatccatccccg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]