LOCUS       XM_055916308            2327 bp    mRNA    linear   VRT 08-MAY-2023
DEFINITION  PREDICTED: Salvelinus fontinalis copper-transporting ATPase 2-like
            (LOC129849485), partial mRNA.
ACCESSION   XM_055916308
VERSION     XM_055916308.1
DBLINK      BioProject: PRJNA962531
KEYWORDS    RefSeq.
SOURCE      Salvelinus fontinalis (brook trout)
  ORGANISM  Salvelinus fontinalis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Protacanthopterygii;
            Salmoniformes; Salmonidae; Salmoninae; Salvelinus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_026601697) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_029448725.1-RS_2023_04
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 04/27/2023
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..2327
                     /organism="Salvelinus fontinalis"
                     /mol_type="mRNA"
                     /isolate="EN_2023a"
                     /db_xref="taxon:8038"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="heart"
                     /dev_stage="smolt"
     gene            1..>2327
                     /gene="LOC129849485"
                     /note="copper-transporting ATPase 2-like; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 34 Proteins"
                     /db_xref="GeneID:129849485"
     CDS             168..>2327
                     /gene="LOC129849485"
                     /codon_start=1
                     /product="copper-transporting ATPase 2-like"
                     /protein_id="XP_055772283.1"
                     /db_xref="GeneID:129849485"
                     /translation="

MFSQNPISSLTKYVSKPSVVGQVEVCMVECQSPCAVRTAVPDGQTADHGRVANQADLKEKMCPCEAWCSQKRTYENLAYEPGSQSELYPQPKALSRAVFQLSGLTPKSSIQAIESHVASLKGVVSVNFSVASGLAQVDYNASSVSTRELSLAIQAMGYGVVDVAGEEVTKIGETEATESLTRIGVKGMTCQSCVRSIEGWIGTLPGVLHIKVSLSDQEAVVRFQPHTVTSEEVKEQIENMGFGATLTNKDTSIDCGQGETHASSSILDSLTQTSVIGIVGMTCNSCVQSIEGKISEMTGVCSIAVSLKEEQGTVTFDPSLTQPEELRAAIEDMGFDASLIESGSAETLPTPPLQEPKTPLSPHFPRMAHSSSGSTKTSINGSSGSTKTSINGSSGSTKTSINGSSGSTKMATAGEEGKVQKCFIRVTGMTCASCVANIERNLVKHRGVISVLVALMAGKAEVKYDPGIVDAKRITQLIEGLGFGATLIEDNVVMDGKLDLSVTGMTCASCVHNIESKLTRTKGILEASVALATNKAQIKFDPEVLGARDIIRMIEGLGFGASLMKAEGFGNNLDHGEEIQQWKNSFLFSLVFGVPVMGLMIYMMVMDSQHGEHGGSMPEEQNLLPGLSLLNLAFFLLCTPVQIFGGRYFYIQAYRSLRHRTANMDVLIVLATSIAYIYSVVVLIVAMAERANQSPVTFFDTPPMLFVFIALGRWLEHIAK"

     misc_feature    459..647
                     /gene="LOC129849485"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(477..485,492..494)
                     /gene="LOC129849485"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    720..902
                     /gene="LOC129849485"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(729..737,744..746)
                     /gene="LOC129849485"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    999..1181
                     /gene="LOC129849485"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1008..1016,1023..1025)
                     /gene="LOC129849485"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1437..1625
                     /gene="LOC129849485"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1452..1460,1467..1469)
                     /gene="LOC129849485"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1656..>2327
                     /gene="LOC129849485"
                     /note="Cation transport ATPase [Inorganic ion transport
                     and metabolism]; Region: ZntA; COG2217"
                     /db_xref="CDD:225127"
ORIGIN      

gtagaggtaaccgcaagcagtgcgactggacttcaatcatgcgcacagctctgcactctgcgctctctgacattatagtggcgtgttgcctaatagaaacgtgaaccacgaacttttgccctctcttgtgtgatgagaaacaaataaagaaccacagagaagtgaccatgttttcgcaaaatccgataagtagccttactaaatatgtttcgaagccgtcagtcgtgggacaggttgaggtttgtatggttgaatgtcagtcgccttgcgcggttaggacagctgtaccagacggacaaaccgccgatcatgggagggtagcaaatcaggctgatctgaaggagaagatgtgtccctgtgaggcctggtgttcccagaagcggacctatgagaacctggcctacgagcctgggagtcagagtgagctctacccccaacctaaggccctctcccgggctgttttccagctctctggcctcacccccaagtcctccatccaggccatcgagagccacgttgctagcctgaagggagtggtgtctgtcaacttctctgtggccagtggcctggctcaggtggactataacgcatcatctgtctctaccagggagttatctctggcgatccaggccatgggctacggcgtcgtggatgtggctggggaagaggtgactaagatcggggagacggaggccacagagtccctgacgaggatcggggtgaagggtatgacatgccagtcctgtgtgcgctccatcgagggatggatagggactctgcctggagttctgcacatcaaggtgtctctgagcgatcaagaggcagtagtacgatttcagccccacacagtgacatctgaggaggtaaaggaacagattgagaacatgggatttggtgcgactcttacgaacaaagacacaagtatagattgtgggcaaggggagacacatgcgtcatcctccatcttggattcactgactcagacgtctgtcattgggattgtagggatgacctgtaattcatgtgtccagtccatagagggaaagatctctgagatgactggggtgtgttctatagcggtgtcattaaaggaggaacagggaaccgtcacctttgaccccagtctgactcagccagaggaattaagggcagccattgaagacatgggatttgatgcttcactcatagaatctggttctgcagaaactctaccaacccctccccttcaagaaccaaagactcccctttccccccacttccccagaatggctcacagtagctctggctctaccaagacttccattaacggtagctctggctctaccaagacttccattaacggtagctctggctctaccaagacttccattaacggtagctctggctctaccaagatggccactgccggtgaggaggggaaggttcagaagtgcttcatccgtgtgacaggcatgacctgtgcctcctgtgtggccaacattgagaggaacttagtcaaacacagaggtgtcatctcagtgctggttgccctcatggctggtaaggcggaggtgaagtatgaccctggtattgttgatgccaagcggataacacagctcatagagggtctaggcttcggtgccacactgatagaggacaatgttgttatggatgggaaactggacctctctgtaactgggatgacatgtgcgtcgtgtgtccataacattgagtccaaactcaccaggactaaagggattctggaagcctcagttgcactggcaaccaacaaagcccagatcaagtttgacccagaagtgcttggagctcgtgacatcatcagaatgattgaggggctaggctttggggcgtctctaatgaaagctgaaggctttgggaacaacctggatcatggggaagagattcaacagtggaagaactcgttcctgttcagtctggtgtttggggtgccagtgatgggcttgatgatctacatgatggtgatggacagtcagcacggggaacacggtggctctatgcccgaggagcagaaccttctcccaggcctctccctcctcaacctggccttcttcctgctctgtacacctgtccaaatctttgggggtcgttatttctacatccaggcgtaccgctcgttgagacaccgcacggctaacatggacgtcctcatcgtcctggcaacctccatcgcctacatctactcagttgtggtcctcatcgtggcgatggcagagagagccaatcagagccctgtcaccttctttgacaccccgcccatgctcttcgtcttcatcgccctgggccggtggctggagcacatagcaaag

//