2024-05-07 01:48:24, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_053224903 2761 bp mRNA linear MAM 04-APR-2023 DEFINITION PREDICTED: Acinonyx jubatus dicer 1, ribonuclease III (DICER1), transcript variant X9, mRNA. ACCESSION XM_053224903 VERSION XM_053224903.1 DBLINK BioProject: PRJNA923316 KEYWORDS RefSeq. SOURCE Acinonyx jubatus (cheetah) ORGANISM Acinonyx jubatus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Carnivora; Feliformia; Felidae; Acinonychinae; Acinonyx. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_069386) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_027475565.1-RS_2023_04 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 04/03/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2761 /organism="Acinonyx jubatus" /mol_type="mRNA" /isolate="Ajub_Pintada_27869175" /db_xref="taxon:32536" /chromosome="B3" /sex="female" /tissue_type="blood" /dev_stage="adult" /collected_by="Rui Bernardino" gene 1..2761 /gene="DICER1" /note="dicer 1, ribonuclease III; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 Protein" /db_xref="GeneID:106977463" CDS 327..2618 /gene="DICER1" /codon_start=1 /product="endoribonuclease Dicer isoform X7" /protein_id="XP_053080878.1" /db_xref="GeneID:106977463" /translation="
MNESPALQPLSMAGLQLVTPASSPMGPFFGLPWQQEAIHDNIYTPRKYQVELLEAALDHNTIVCLNTGSGKTFIAVLLTKELSYQIRGDFNRSGKRTVFLVNSANQVAPQVSAVRTHSDLKVGEYSSLEVNAAWTKEKWNQEFTKHQVLVMTCYVALNVLKNGYLSLSDINLLVFDECHLAILDHPYREIMKLCENCPSCPRILGLTASILNGKCDPEELEEKIQKLEKILKSNAETATDLVVLDRYTSQPCEIVVDCGPFTDRSGLYGRLLLELEEALNFINDCNISVRSKERDSTSISKQILSDCRAVLVVLGPWCADKVAGMMVRELQKYIKHEQEELHRKFLLFTDTFLRKIHALCEEHFSPASLDLKFVTPKVIKLLEILRKYKPYERQQFESVEWYNNRNQDNYVSWSDSEDDDEDEEIEEKEKPETNFPSPFTNILCGIIFVERRYTAVVLNRLIKEAGKQDPELAYISSNFITGHGIGKNQPRNKQMEAEFRKQEEVLRKFRAHETNLLIATSIVEEGVDIPKCNLVVRFDLPTEYRSYVQSKGRARAPISNYIMLADTDKIKSFEEDLKTYKAIEKILRNKCSKSVDAGETDVDPVVDDDDVFPPYVLRPDDGGPRVTINTAIGHINRYCARLPSDPFTHLAPKCRTRELPDGTFYSTLYLPINSPLRASIVGPPMSCIRLAERVVALICCEKLHKIGELDDHLMPVGKETVKYEEELDLHDEEETSVPGRPGSTKRRQCYPKAVSIDSGMFEG"
misc_feature 453..1046 /gene="DICER1" /note="DEXH-box helicase domain of endoribonuclease Dicer; Region: DEXHc_dicer; cd18034" /db_xref="CDD:350792" misc_feature order(453..464,471..473,522..545,666..668,855..857, 948..950) /gene="DICER1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:350792" misc_feature order(630..635,702..707,780..782,786..791,798..800, 873..881) /gene="DICER1" /note="nucleic acid binding site [nucleotide binding]; other site" /db_xref="CDD:350792" misc_feature 1164..1424 /gene="DICER1" /note="Partner-binding domain of the endoribonuclease Dicer; Region: Dicer_PBD; cd15903" /db_xref="CDD:277191" misc_feature order(1167..1169,1173..1178,1353..1358,1365..1370, 1377..1379,1386..1391,1398..1400) /gene="DICER1" /note="Trbp binding interface [polypeptide binding]; other site" /db_xref="CDD:277191" misc_feature 1443..2021 /gene="DICER1" /note="C-terminal helicase domain of the endoribonuclease Dicer; Region: SF2_C_dicer; cd18802" /db_xref="CDD:350189" misc_feature order(1674..1682,1890..1892,1947..1949,1953..1955) /gene="DICER1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:350189" misc_feature order(1902..1904,1908..1910,1983..1985,1989..1991) /gene="DICER1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:350189" misc_feature 2217..2483 /gene="DICER1" /note="Dicer dimerization domain; Region: Dicer_dimer; pfam03368" /db_xref="CDD:427264" ORIGIN
acggcgagcgggaggaaatggcggcggcggcgccaggcggcaccgggaggcctgggctgtgacgcgcgcgccggagcggggtccgatggttctcgaaggcccgcggcgccccgtgctgcaggttacctagggtgtgaattaatacagacttggaaactgaaagaacttagaatcagcattttgagagcagaagcttgggcatgctgtgattttccaataaactgctatcacaatgtcaaaatgcagctcggacaacagcagcacagagatctcaaacattaaaacgtaagctgcgctagagcaaaatgcagtgagagaagcactggatgaatgaaagccctgctttgcagcccctcagcatggcgggcctgcagctcgtgacccctgcctcctcaccaatgggccctttctttggactgccatggcaacaagaagcaatccatgataacatttatacgccaagaaaataccaggtggaactgctcgaagcagctctggatcataacaccatagtctgtttaaacactggctcagggaagacgtttattgccgtactactcactaaagagctgtcctatcagatcaggggagacttcaacagaagcggaaaaaggacggtgttcttggtcaactctgcaaaccaggttgctccacaagtgtcagctgtcagaactcattcagatctcaaggttggggaatactcaagcctggaagtaaatgcagcttggacaaaagagaaatggaaccaagagtttactaagcaccaggttcttgttatgacctgctatgtcgccttgaatgttttgaaaaatggttacttatcgctgtcggacattaaccttttggtgtttgatgagtgtcatcttgcgatcctagaccacccctaccgagaaattatgaagctctgtgaaaactgtccatcgtgtcctcgtatcttgggactgactgcttccattttaaatgggaaatgcgaccccgaggaattggaagaaaagattcagaagctggagaaaatcctcaagagtaatgctgagaccgcaactgacctggtggtcttggacagatacacttctcaaccgtgtgagattgtggtggactgtgggccgttcacggaccgaagtggcctctatggcaggctgctgctggagctggaggaggcgctgaactttatcaacgactgtaacatatctgtgcgttcgaaagagagagattcgacttcaatttctaagcagatactgtcagactgtcgtgccgtgttggtggtcctgggcccctggtgtgcagataaggtcgctgggatgatggtccgggagctgcagaagtacatcaaacacgagcaagaggagctgcacaggaaattcctattgtttacagacaccttcctaaggaaaatccatgcactatgtgaagagcacttctctcctgcctcacttgacctgaaatttgtaactcctaaagtaataaaactgctcgaaatcttgcgcaagtacaaaccgtatgagcggcagcagttcgagagcgtcgagtggtataataacaggaatcaggataattacgtgtcctggagtgattctgaggatgatgacgaggacgaagagatcgaagaaaaagagaagccggagaccaacttcccgtctccgttcaccaacatcttatgcgggatcatttttgtggaaagaagatacacagcagttgtcttaaacagattgataaaggaagctggcaaacaagatccagagctggcttacatcagcagcaattttataactggacatggcattggaaagaatcagcctcgtaacaaacagatggaagcagaattcagaaaacaggaagaggtacttaggaaatttcgagcacatgagaccaacctgcttattgcgacaagcattgtggaagagggtgttgacataccaaaatgcaacttggtggttcgttttgatttacccacagagtatcgatcctatgttcaatctaagggacgagcaagggcaccgatctctaattacataatgttagcagatacagacaaaataaaaagttttgaagaagaccttaaaacatacaaagctattgaaaagatcttgagaaacaagtgttccaagtccgttgatgcgggtgagactgacgttgatcctgtcgtggatgatgacgatgtgttcccgccatatgtgttgaggcccgatgacggtggtccgcgagtcacgatcaacacggccattggacacatcaacagatactgtgctagattaccaagtgatccgtttactcatctagctcctaaatgtagaactcgagagttgcctgatggtacattttattcaactctttatctgccaattaactcacctcttcgagcctccattgttggtccgccaatgagctgtatacgattggccgaaagagttgtagctctcatttgctgtgaaaaactgcacaaaattggtgaactggatgaccatttgatgccagttgggaaagagacggttaaatatgaagaagagctcgatttacatgacgaagaagagaccagcgttccaggaagaccaggttccacaaagcgaagacagtgctacccaaaggcagttagtatcgattccggaatgtttgagggatagctatcccaaacccgatcagccctgttacctgtatgtgataggaatggttctgacgacacccttacctgatgaactcaacttcagaaggcggaagctctatccccctgaggataccaccagatgctttggaatactgacggcca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]