GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-19 10:04:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_051729041             696 bp    mRNA    linear   PLN 03-NOV-2022
DEFINITION  Alternaria postmessia uncharacterized protein (J4E82_002743),
            partial mRNA.
ACCESSION   XM_051729041
VERSION     XM_051729041.1
DBLINK      BioProject: PRJNA858129
            BioSample: SAMN18144516
KEYWORDS    RefSeq.
SOURCE      Alternaria postmessia
  ORGANISM  Alternaria postmessia
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Dothideomycetes; Pleosporomycetidae; Pleosporales; Pleosporineae;
            Pleosporaceae; Alternaria; Alternaria sect. Alternaria.
REFERENCE   1  (bases 1 to 696)
  AUTHORS   Fulcher,M.
  TITLE     Comparative genomics of the Alternaria infectoria species group
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 696)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (02-NOV-2022) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 696)
  AUTHORS   Fulcher,M.
  TITLE     Direct Submission
  JOURNAL   Submitted (26-MAR-2021) Plant Pathology and Plant Microbe Biology,
            Cornell University, 334 Plant Science Building, Ithaca, NY 14851,
            USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_026260084).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..696
                     /organism="Alternaria postmessia"
                     /mol_type="mRNA"
                     /strain="BMP 2775"
                     /host="Citrus x tangelo"
                     /type_material="culture from holotype of Alternaria
                     postmessia"
                     /db_xref="taxon:1187938"
                     /chromosome="Unknown"
                     /country="USA: Florida"
                     /collection_date="1980"
     gene            <1..>696
                     /locus_tag="J4E82_002743"
                     /db_xref="GeneID:76126596"
     CDS             1..696
                     /locus_tag="J4E82_002743"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_051591133.1"
                     /db_xref="GeneID:76126596"
                     /db_xref="InterPro:IPR001424"
                     /db_xref="InterPro:IPR006121"
                     /db_xref="InterPro:IPR024134"
                     /db_xref="InterPro:IPR036163"
                     /db_xref="InterPro:IPR036423"
                     /db_xref="PFAM:PF00080"
                     /db_xref="PFAM:PF00403"
                     /translation="
MTCQSCINDIEGSLQQLGGINKVTANLKDQLVSIEGTAAPSAIVEAIQATGRDAILRGSGRSDSAAVCILESHAPHVENKVRGLVRMVEVAPSMTIIDLSIRGLSPGTYHATIRESGNISDGPESTGAIWEHHKAKQEGKPCRGVFGTVQVGKGGVGSVFLDKPIHIWEMIGRSIVVAKEQDGKFDKNDPDTLVGVIARSAGVWDNDKTVCSCSGKTVWQEREEQRDRGML"
     misc_feature    1..660
                     /locus_tag="J4E82_002743"
                     /note="copper, zinc superoxide dismutase; Region:
                     PLN02957"
                     /db_xref="CDD:215516"
ORIGIN      
atgacctgccagtcatgcatcaacgacattgaaggttctctgcagcagttgggtggtatcaacaaagtcactgccaacctcaaagatcaactagtatctatcgagggtacagcagcaccatcggcaatcgttgaagctattcaagctactggtcgtgatgcaattctaagaggatctggaagatcagacagcgccgcagtttgcattctagaatcgcatgcaccgcatgtagagaacaaggttcgagggcttgtgcgcatggtggaagtggctccaagtatgaccatcattgacctgagtatacgaggattgtcgcctggaacataccatgcaactatccgcgaatctggcaacatatccgacggacctgaatctaccggcgccatctgggaacatcacaaagccaaacaggagggcaagccgtgtcgaggcgtctttggaaccgttcaggtagggaagggtggagtcggatctgtgttcctggataagcccatccacatctgggagatgatcggacgcagcatcgtagttgcaaaggagcaagacggcaagtttgataagaacgatccggatacgctagtgggtgtcattgcacgtagcgctggtgtttgggacaacgacaagacggtatgttcgtgttccggaaagacggtctggcaggagagagaggagcagcgcgaccgtgggatgctatga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]