2024-05-19 10:04:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_051729041 696 bp mRNA linear PLN 03-NOV-2022 DEFINITION Alternaria postmessia uncharacterized protein (J4E82_002743), partial mRNA. ACCESSION XM_051729041 VERSION XM_051729041.1 DBLINK BioProject: PRJNA858129 BioSample: SAMN18144516 KEYWORDS RefSeq. SOURCE Alternaria postmessia ORGANISM Alternaria postmessia Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Dothideomycetes; Pleosporomycetidae; Pleosporales; Pleosporineae; Pleosporaceae; Alternaria; Alternaria sect. Alternaria. REFERENCE 1 (bases 1 to 696) AUTHORS Fulcher,M. TITLE Comparative genomics of the Alternaria infectoria species group JOURNAL Unpublished REFERENCE 2 (bases 1 to 696) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (02-NOV-2022) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 696) AUTHORS Fulcher,M. TITLE Direct Submission JOURNAL Submitted (26-MAR-2021) Plant Pathology and Plant Microbe Biology, Cornell University, 334 Plant Science Building, Ithaca, NY 14851, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_026260084). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..696 /organism="Alternaria postmessia" /mol_type="mRNA" /strain="BMP 2775" /host="Citrus x tangelo" /type_material="culture from holotype of Alternaria postmessia" /db_xref="taxon:1187938" /chromosome="Unknown" /country="USA: Florida" /collection_date="1980" gene <1..>696 /locus_tag="J4E82_002743" /db_xref="GeneID:76126596" CDS 1..696 /locus_tag="J4E82_002743" /codon_start=1 /product="uncharacterized protein" /protein_id="XP_051591133.1" /db_xref="GeneID:76126596" /db_xref="InterPro:IPR001424" /db_xref="InterPro:IPR006121" /db_xref="InterPro:IPR024134" /db_xref="InterPro:IPR036163" /db_xref="InterPro:IPR036423" /db_xref="PFAM:PF00080" /db_xref="PFAM:PF00403" /translation="
MTCQSCINDIEGSLQQLGGINKVTANLKDQLVSIEGTAAPSAIVEAIQATGRDAILRGSGRSDSAAVCILESHAPHVENKVRGLVRMVEVAPSMTIIDLSIRGLSPGTYHATIRESGNISDGPESTGAIWEHHKAKQEGKPCRGVFGTVQVGKGGVGSVFLDKPIHIWEMIGRSIVVAKEQDGKFDKNDPDTLVGVIARSAGVWDNDKTVCSCSGKTVWQEREEQRDRGML"
misc_feature 1..660 /locus_tag="J4E82_002743" /note="copper, zinc superoxide dismutase; Region: PLN02957" /db_xref="CDD:215516" ORIGIN
atgacctgccagtcatgcatcaacgacattgaaggttctctgcagcagttgggtggtatcaacaaagtcactgccaacctcaaagatcaactagtatctatcgagggtacagcagcaccatcggcaatcgttgaagctattcaagctactggtcgtgatgcaattctaagaggatctggaagatcagacagcgccgcagtttgcattctagaatcgcatgcaccgcatgtagagaacaaggttcgagggcttgtgcgcatggtggaagtggctccaagtatgaccatcattgacctgagtatacgaggattgtcgcctggaacataccatgcaactatccgcgaatctggcaacatatccgacggacctgaatctaccggcgccatctgggaacatcacaaagccaaacaggagggcaagccgtgtcgaggcgtctttggaaccgttcaggtagggaagggtggagtcggatctgtgttcctggataagcccatccacatctgggagatgatcggacgcagcatcgtagttgcaaaggagcaagacggcaagtttgataagaacgatccggatacgctagtgggtgtcattgcacgtagcgctggtgtttgggacaacgacaagacggtatgttcgtgttccggaaagacggtctggcaggagagagaggagcagcgcgaccgtgggatgctatga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]