2024-05-18 13:59:22, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_051103271 1481 bp mRNA linear VRT 26-FEB-2023 DEFINITION PREDICTED: Labeo rohita uncharacterized LOC127160616 (LOC127160616), mRNA. ACCESSION XM_051103271 VERSION XM_051103271.1 DBLINK BioProject: PRJNA887821 KEYWORDS RefSeq; includes ab initio. SOURCE Labeo rohita (rohu) ORGANISM Labeo rohita Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Cyprinidae; Labeoninae; Labeonini; Labeo. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_026129321) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_022985175.1-RS_2023_02 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 02/26/2023 ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 28% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..1481 /organism="Labeo rohita" /mol_type="mRNA" /strain="BAU-BD-2019" /isolation_source="riverine" /db_xref="taxon:84645" /chromosome="Unknown" /sex="male" /tissue_type="blood" /dev_stage="adult" gene 1..1481 /gene="LOC127160616" /note="uncharacterized LOC127160616; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:127160616" CDS 1..1440 /gene="LOC127160616" /codon_start=1 /product="uncharacterized protein LOC127160616" /protein_id="XP_050959228.1" /db_xref="GeneID:127160616" /translation="
MGHLYELLVYTVQRDCGVQLFCSEHLDMMKSFQLYHLQLLYLLIAALLECEVVTQRRCKQVHHLNINCVQGDNMSISCLTTTHPLQSLTVKLHRTNQDKNILMYPDISPEPEHQRWSVRKDAGNVTLDLKDIRLSDHGLYDCQVYKNQDCLNVIRFNLKVKECKTLDSVHPTPGSSVLLPCSEHPLQNRTEQVNWTVVIGHQSTDITQYRPPNKPSSSTENLLKPLYERVRQLKNGSLLITDVVHTDELWYQCRVNEKTCYEVKLLLKECKTLDSVHPTPGSSVLLPCSEHPLQHRTEQVNWTVVIGHQSTDITQYRPPNKPSSSTENLLKPLYERVRQLKNGSLLITDVVHTDELWYQCRVNEKTCYEVKLLLLKVITDAPTPADSTVFQTEDYSTDESETVTTETVTVNLTVVVMITIVSLCVLISLTVLYFKQPRPEFDNQIESNCQTIVYYSKVSGGLDVPLYSLVQRNTNHDHL"
misc_feature 193..426 /gene="LOC127160616" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 220..234 /gene="LOC127160616" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 259..273 /gene="LOC127160616" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 373..387 /gene="LOC127160616" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature <682..>759 /gene="LOC127160616" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 706..720 /gene="LOC127160616" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature <1003..>1080 /gene="LOC127160616" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1027..1041 /gene="LOC127160616" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" ORIGIN
atggggcacctatatgagctgctggtttacacagtgcagagagattgtggagttcaactgttctgcagtgagcatctggatatgatgaagagttttcagctttaccatttacaactcctgtatcttctaatagcagctttattagaatgcgaagtggtgacacagagacgctgcaaacaggttcatcacttgaacataaactgtgttcagggtgacaacatgtctatttcttgcctaaccacaacccacccgctgcagtctctaacagtgaaactgcacaggaccaaccaagataaaaacatcctgatgtatccagacatctctccagaaccagagcaccagagatggtctgtgaggaaagatgctggaaatgttacacttgatctgaaagacatcagattatccgatcatggcctttatgactgtcaggtctacaagaatcaggactgccttaatgtcattcgatttaacctaaaagtcaaagaatgtaaaactttggactctgttcatccaacaccaggctcttcagtgttgctgccatgctctgaacatcctctacaaaacagaactgaacaagtcaattggacagttgttattggtcaccagtcaacagatataactcagtatcgcccaccaaacaagccctcaagcagcacagagaatctcctgaagcctctgtatgaaagagtgagacaactaaaaaacggatctctgcttataacagatgtagttcacactgatgaattgtggtatcagtgcagagtgaatgaaaaaacctgctatgaagtgaagctgctcctgaaagagtgtaaaactttagactctgtccatccaacaccaggctcttcagtgttgctgccatgctctgaacatcctctacaacacagaactgaacaagtcaattggacagttgttattggtcaccagtcaacagatataactcagtatcgcccaccaaacaagccctcaagcagcacagagaatctcctgaagcctctgtatgaaagagtgagacaactaaaaaacggatctctgcttataacagatgtagttcacactgatgaattgtggtatcagtgcagagtgaatgaaaaaacctgctatgaagtgaagctgctgctgctgaaagtgatcacagatgctccaaccccagctgacagtacggtttttcagactgaagactacagtactgatgagagtgaaacagtgacaactgaaacagtgacagttaatctgacagtggtggtgatgatcacaatagtgtctctgtgtgtcctcatatcactgaccgttctttatttcaaacaaccaagaccagaatttgacaaccaaattgaatcaaactgccagactatcgtatattattctaaagtttcaggagggttggatgtcccgttgtattctttagttcaacgtaacacaaaccatgaccacctctagtgtgaagaaactgaagcttctgcatgtaatccagaccacat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]