LOCUS       XM_050732186            3402 bp    mRNA    linear   INV 23-SEP-2022
DEFINITION  PREDICTED: Bombus affinis copper-transporting ATPase 1
            (LOC126921033), transcript variant X14, mRNA.
ACCESSION   XM_050732186
VERSION     XM_050732186.1
DBLINK      BioProject: PRJNA880876
KEYWORDS    RefSeq.
SOURCE      Bombus affinis
  ORGANISM  Bombus affinis
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita;
            Aculeata; Apoidea; Anthophila; Apidae; Bombus; Bombus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_066353) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: Bombus affinis Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3402
                     /organism="Bombus affinis"
                     /mol_type="mRNA"
                     /isolate="iyBomAffi1"
                     /isolation_source="nest"
                     /db_xref="taxon:309941"
                     /chromosome="10"
                     /sex="male"
                     /tissue_type="slice of abdomen"
                     /dev_stage="adult"
                     /country="USA: Minnesota, Redwing, Goodhue County"
                     /collection_date="2020-08-04"
                     /collected_by="Elaine Evans"
                     /identified_by="Elaine Evans"
     gene            1..3402
                     /gene="LOC126921033"
                     /note="copper-transporting ATPase 1; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:126921033"
     CDS             59..3262
                     /gene="LOC126921033"
                     /codon_start=1
                     /product="copper-transporting ATPase 1 isoform X6"
                     /protein_id="XP_050588143.1"
                     /db_xref="GeneID:126921033"
                     /translation="

MKYPLPLCKVHKKLVANRSNFHYRSFPCLQFYDDNMIDENMKLLGDEEDDTDYEGTTQMVYVSRSQKMKDSTNTSTMKVNIDGMRCQSCVKNIEGTIGSRPEVLSVKVILEEKLGYVEYKAEEITPNELVEAIEDMGFTASLCSDESNAIEKIEKNDSLQSTISICTVHIDGMTCASCVKTIIDNLSEKAGIKQANVSLEKKEATVSYNDKDLTAEQISGFIEEMGFNSFVKEVNGKVVGEETPMNLSLKNNSAQEELPLQMNGGGDVKTQNETAKCFLHITGMTCASCVAAIEKHCKKLYGVNNILVALMAAKAEVVFDPNKIRAIDIASSISELGFPTTLIEESGTGEGDIELKITGMTCASCVNKIESTVKKLPGVHSATVALATQRGKFKYDVEKIGVRDIIECINKLGFTAMLFSNKDKENRDYLDQREEINKWRTAFLVSLIFGIPCMLAMTYFMVIMSIGEKTHEDMCCVVPGLSWENLILFIFSTPVQFFGGWHFYVQAYKALKHGTTNMDVLISMTTTISYLYSVAVLAAAMIMQEHVSPQTFFDTPPMLLVFISLGRWLEHVAKGKTSEALSKLLSLKATDAVLVTLGPNNELLSERLITIDLVQRGDILKVVQGAKVPVDGRVLSGNSTCDESLITGESMPVPKKKGSVVIGGSINQNGPLLITATHTGEHTTLAQIVRLVEEAQTNKAPIQHLADKIAGYFIPFVIVVSIVTLFVWIVVGYVNVNSLPISHNDQINKHGMNREEIIFQYAFRSALCVLAIACPCALGLATPTAVMVGTGVGALNGILIKGAEPLENAHKVKCIVFDKTGTITHGIPMVTKINLFVNETAYSLAKFLVIICTAETNSEHPIASAIVRYVKETIGSEATGQCMNFQAVAGCGLKCKVSHISTTLADALKSDKILNYINEVKRLPSGTHNLNNVSIDVTPISSTRQNLELLLSPDSHGDQTNPDDVYEICVGNREWMRRNAINIPQEVELKMVTEEDLGHTAVLAAVNNVLVAMISVADTVKPEAHLAIYTLKKMGLEVILLTGDNRKTAVSIARQSICRSVTFAQSC"

     misc_feature    290..481
                     /gene="LOC126921033"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(308..316,323..325)
                     /gene="LOC126921033"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    566..739
                     /gene="LOC126921033"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(575..583,590..592)
                     /gene="LOC126921033"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    899..1081
                     /gene="LOC126921033"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(908..916,923..925)
                     /gene="LOC126921033"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1118..1306
                     /gene="LOC126921033"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1136..1144,1151..1153)
                     /gene="LOC126921033"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1385..>3223
                     /gene="LOC126921033"
                     /note="Haloacid Dehalogenase-like Hydrolases; Region:
                     HAD_like; cl21460"
                     /db_xref="CDD:451251"
ORIGIN      

tatatatatacacacatatgtatatgatcttgagaaaactgaaattccatctagaacgatgaaatatcctttacctttgtgcaaagttcacaagaaattagtagcgaatcggtcaaatttccactatcggtcgtttccttgcttgcagttttacgacgacaatatgatcgatgagaatatgaaactacttggcgatgaggaggacgataccgattacgaaggcacgacacagatggtgtacgtttctcggtcgcagaaaatgaaagattccacgaatacttctactatgaaggttaatatcgacggtatgagatgccagagctgtgtgaagaacatcgagggaaccataggtagccgaccggaggttttaagcgttaaagtaatcctagaagagaagctcggttacgtcgaatataaagcggaagaaattacgccgaacgaattggtcgaagcgatagaggatatgggattcaccgcttccctatgcagcgacgaaagtaacgctatcgaaaagatagaaaaaaatgattcgttacaatcaactatcagtatttgtactgtacatattgatggaatgacttgtgcgtcttgtgttaaaactatcattgacaatctatcggagaaagcaggaataaaacaagcgaacgttagtttagagaagaaggaagctacggtttcttataacgacaaggacctaacagctgaacaaatatcagggttcatcgaagaaatgggttttaattcgtttgttaaagaagtaaacggtaaagttgtaggagaggaaacaccaatgaatttatcgttgaaaaacaattccgcgcaagaggaacttccgttgcaaatgaatgggggaggtgatgtaaagactcaaaacgaaacagcaaaatgctttttacatataacggggatgacctgtgcttcctgcgttgctgccatagaaaaacattgcaaaaaattatacggtgtaaataatatcttggtcgcattgatggcggccaaggcagaagttgtctttgatccgaataagataagggcgattgacatcgcttctagcatatcggaattgggcttccctactactttgatcgaggaatctggtactggagagggagatattgaattaaaaatcacaggtatgacatgtgcatcttgcgtgaataagatagaatcgactgtgaagaaattaccaggcgtccattctgccacagttgcgttggcaactcaacgtggcaaattcaaatacgatgtagaaaaaattggcgtcagggacattatcgaatgcattaacaaattaggtttcaccgcaatgttatttagtaataaagataaagaaaacagagactacttggatcagagggaagaaataaacaagtggcggacagcttttttagtgtccttaatatttggcataccgtgtatgttagccatgacatactttatggtaatcatgtctattggtgaaaaaacgcacgaagatatgtgctgcgtagttcctggtctttcctgggaaaatttaatccttttcatattttctacaccagtccagttttttggcggctggcatttttacgttcaagcgtacaaagctttgaaacacggtacaactaatatggatgttttaatttctatgactactacgatatcttatttgtactcagtcgccgtacttgcagcagctatgataatgcaggaacacgttagtcctcagacattttttgatactcctcccatgttgttagtgttcatcagtttaggaagatggttagaacatgtcgcaaagggtaaaacctcggaggcgttatcgaaattattgtctttgaaagcaacggacgcggtcctggttactttgggccctaacaatgaactactatctgagcgtttaatcactatagatttggtacaacgaggcgatatcttaaaagtagtgcaaggtgccaaagttcccgtcgatggtagagttttatcaggcaattctacttgcgacgagagtctaattaccggggaaagtatgccggtaccaaaaaagaagggatcggttgtaataggtggctcgataaatcaaaatggtccgcttctaattactgccacgcatacaggagaacacacgacattggcacaaattgtacgattagtagaagaggcacaaacgaataaggcacctattcaacatttagccgataagatagctggttatttcataccttttgttatagttgtttctatagtaactttattcgtttggatagtagtgggatatgtaaatgtaaacagtttaccaatctcgcacaacgatcaaatcaataaacacggaatgaatagagaagaaattatatttcaatacgcttttcgaagcgcgctttgcgtattagcaatagcttgtccatgcgcgttaggattggctacgccaactgctgttatggttggtactggagtcggagcattaaatggtatcttaataaaaggtgctgaacctttggaaaatgcgcacaaagttaagtgtattgtgtttgataagaccggaacaataacacatggtataccaatggtaacaaagataaatctctttgtaaatgaaacagcttattcactagcaaagtttttagtcattatctgtacagctgaaacaaatagcgaacatccgatcgcatcagcaattgtgcgctacgtgaaggaaacaataggctctgaagcaactgggcagtgcatgaattttcaagcagttgctggttgtggacttaaatgtaaagtatcacatatttcaactacgttggccgatgcattaaaatctgataagattcttaactatattaacgaggtaaaaagattaccttctggaacgcataacttaaataatgtgtcaatcgatgttacgccaatttcgagcacgagacaaaatttggaattgttgctaagtccggattcccatggtgaccagactaatcctgacgatgtatatgaaatttgcgttggtaacagagagtggatgcgaagaaatgctattaatataccacaagaagtagagttgaaaatggttactgaagaagatctaggacatactgctgttttagcagcagtgaataatgtactggtggctatgatcagcgtagcagatacggttaaaccagaagcccatctggcaatctatactttgaaaaaaatgggtttagaagttattcttttaacaggagataataggaagactgctgtttctatcgctagacaaagtatttgcagaagtgttaccttcgcacaaagttgctaaaattcaacgtttacaagatcaaggcttaagagttgcaatggtaggagatggtgttaatgatagtcctgcccttgcacaatcagatgttggcattgctatatcttctggtacggatgttgctgttgaagctgccgatgtag

//