LOCUS       XM_050086924            2310 bp    mRNA    linear   INV 15-AUG-2022
DEFINITION  PREDICTED: Schistocerca serialis cubense basic proline-rich
            protein-like (LOC126419747), mRNA.
ACCESSION   XM_050086924
VERSION     XM_050086924.1
DBLINK      BioProject: PRJNA857088
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Schistocerca serialis cubense
  ORGANISM  Schistocerca serialis cubense
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Polyneoptera; Orthoptera; Caelifera;
            Acrididea; Acridomorpha; Acridoidea; Acrididae;
            Cyrtacanthacridinae; Schistocerca.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_064646) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: Schistocerca serialis cubense
                                           Annotation Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..2310
                     /organism="Schistocerca serialis cubense"
                     /mol_type="mRNA"
                     /isolate="TAMUIC-IGC-003099"
                     /isolation_source="physical"
                     /sub_species="cubense"
                     /specimen_voucher="TAMUIC-IGC-003099"
                     /db_xref="taxon:2023355"
                     /chromosome="9"
                     /sex="female"
                     /tissue_type="Whole body"
                     /dev_stage="adult"
                     /country="USA: Florida, Islamorada"
                     /collection_date="2021-03-08"
                     /collected_by="Hojun Song"
                     /identified_by="Hojun Song"
     gene            1..2310
                     /gene="LOC126419747"
                     /note="basic proline-rich protein-like; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 1 Protein"
                     /db_xref="GeneID:126419747"
     CDS             1..2310
                     /gene="LOC126419747"
                     /codon_start=1
                     /product="basic proline-rich protein-like"
                     /protein_id="XP_049942881.1"
                     /db_xref="GeneID:126419747"
                     /translation="

MALPLPLPRWLCPCPCLDGSAPAPAPASMALPLPLPLPRCPCPCPCPCLDAPAPAPAPASMPLPLPLPLPRCPCPCPCPCLDAPAPAPAPASMPLPLPLPLPRCPCPCPCLDAPAPAPAPASMALPLPLPRWPCPCPCLDGPAPAPASMALPLPLPRWPCPCPCLDGPAPAPASMALPLPLPRWPCPCPCLDGPAPAPASMALPLPLPRWPCPCPCLDGPAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPAPASMALPLPLPLPRWLCPCPCPCLDGSAPAPAPASMALPLPLPLPRWLCPCPCPCLDGSAPAPAPASMALPLPLPLPRWLCPCPCPCLDGSAPAPAPASMALPLPLPLPRWLCPCPCPCLDGSAPAPAPASMALPLPLPLPRWLCPCPCPCPDGSAPAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPLPRWLCPCPCLDGSAPAPAPASMALPLPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWL"

     misc_feature    <370..912
                     /gene="LOC126419747"
                     /note="large tegument protein UL36; Provisional; Region:
                     PHA03247"
                     /db_xref="CDD:223021"
ORIGIN      

atggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatgcccctgcccctgcccctgcccctgcctcgatgcccctgcccctgcccctgcccctgcctcgatgcccctgcccctgcccctgcccctgcctcgatgcccctgcccctgcccctgcccctgcctcgatgcccctgcccctgcccctgcccctgcctcgatgcccctgcccctgcccctgcccctgcctcgatgcccctgcccctgcccctgcctcgatgcccctgcccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgccccgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcctctgcccctgcctcgatggctctga

//