LOCUS       XM_049383422             570 bp    mRNA    linear   PLN 15-JUL-2022
DEFINITION  Alternaria hordeiaustralica uncharacterized protein (J4E84_000786),
            partial mRNA.
ACCESSION   XM_049383422
VERSION     XM_049383422.1
DBLINK      BioProject: PRJNA858129
            BioSample: SAMN18144517
KEYWORDS    RefSeq.
SOURCE      Alternaria hordeiaustralica
  ORGANISM  Alternaria hordeiaustralica
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Dothideomycetes; Pleosporomycetidae; Pleosporales; Pleosporineae;
            Pleosporaceae; Alternaria; Alternaria sect. Infectoriae.
REFERENCE   1  (bases 1 to 570)
  AUTHORS   Fulcher,M.
  TITLE     Comparative genomics of the Alternaria infectoria species group
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 570)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (15-JUL-2022) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 570)
  AUTHORS   Fulcher,M.
  TITLE     Direct Submission
  JOURNAL   Submitted (26-MAR-2021) Plant Pathology and Plant Microbe Biology,
            Cornell University, 334 Plant Science Building, Ithaca, NY 14851,
            USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_026056773).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..570
                     /organism="Alternaria hordeiaustralica"
                     /mol_type="mRNA"
                     /strain="BMP 2776"
                     /host="Hordeum vulgare"
                     /type_material="culture from holotype of Alternaria
                     hordeiaustralica"
                     /db_xref="taxon:1187925"
                     /chromosome="Unknown"
                     /country="Australia"
                     /collection_date="1996"
     gene            <1..>570
                     /locus_tag="J4E84_000786"
                     /db_xref="GeneID:73445396"
     CDS             1..570
                     /locus_tag="J4E84_000786"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_049248940.1"
                     /db_xref="GeneID:73445396"
                     /db_xref="InterPro:IPR001424"
                     /db_xref="InterPro:IPR006121"
                     /db_xref="InterPro:IPR024134"
                     /db_xref="InterPro:IPR036163"
                     /db_xref="InterPro:IPR036423"
                     /db_xref="PFAM:PF00080"
                     /db_xref="PFAM:PF00403"
                     /translation="

MTVPSFETIFAVPMTCQSCINDIEGSLQQLSGVNKITANLKDQLVSVEGTAAPSAIVEAIQATGRDAILRGSGRSDKNKVRGLVRMVEVAPSMTIIDLSIRGLSPGTYQATVRESGDISDGPESTGAIWEYLKAKKEDKPCRGIFGTIQVGKGGVGSVFLDKPIHIWEMIGRSIVVAREQDGKVCETAS"

     misc_feature    1..546
                     /locus_tag="J4E84_000786"
                     /note="copper, zinc superoxide dismutase; Region:
                     PLN02957"
                     /db_xref="CDD:215516"
ORIGIN      

atgactgtcccgtcgtttgaaaccatcttcgcggtgcctatgacctgccagtcgtgtatcaacgacatcgaaggctccctccagcaactgagtggtgtcaacaaaatcactgccaaccttaaagatcaactggtatctgtcgagggcacagcagcgccatcggccattgttgaggctattcaagcaactggccgtgatgcaattctaagaggatctggaagatcagacaagaacaaagttcgaggattagtgcgcatggttgaagtagctccgagtatgactatcatcgatctgagcataaggggattgtcgcctggaacgtaccaggctacagttcgcgaatctggcgacatatccgacggaccagaatctaccggcgccatctgggagtatctcaaggccaaaaaggaagacaagccgtgtcggggcatctttggaaccatccaggtaggaaagggtggagtcggatctgtgttcctggacaagcccatccacatctgggagatgatcggacgtagcatcgtagttgcgcgagagcaagacggcaaggtatgcgaaaccgctagttga

//